                                                                        Gene putatively regulated by attenuation in B_subtilis

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:80 nt.    Distance to gene:48 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G=-13.70 kcal/mol
Antiterminator:    Distance from promoter:35 nt. Size=56 nt.     Delta G= -6.30 kcal/mol
Anti-antiterminator:   Size=57 nt.     Delta G= -7.30 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAAC-AAAAAT. It has a score value of 62.25 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAACGAAAATGCCCGAAATGCGGAAAAATGCTCGTCGAGAAAAAACTCAAAAAAGG
TATACAAGTCCAATGCGTGGAATGCGATTATAAGGAAGAACCACAGAAGTAGcggtgagca
gggtcttgctcaccttctttgtgtgttaaaagaaggccttgaataataaactaggagatgtgaaagATG

    gid Gene: gid     GI: 16078676     BI number: BSU16130     GOG: COG1206     Description: glucose-inhibited division protei AA A  A        G A  A      A  A GC       A  A AT        GC GC        GC |  A      A  A |  A      A  C C  A      T  A T  A      A  G G  A       TA C  A       TA TG       |  G CG       A  T GT       G  A TA        CG AT        Gc |  A       Tg |  C      A  g A  A      A  t A  A      G  g A  G      G  a       gt AT       T  |      g  c GC       G  |       gt GC        Cg        at |  A       Gc        cg |  A       Ta        gc |  T      A  |       at CG       A  |       gc GC        Cg        ta TG        Cg        gc AT        Tg        gc                         ttctttgtgtgttaaaagaaggccttgaataataaactaggagatgtgaaagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG1206 NAD(FAD)-utilizing enzyme possibly involved in translation ... can be seen here     ..................................................................................................................