                                                                        Gene putatively regulated by attenuation in B_subtilis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:211 nt.     Distance to run of Ts=1 nt.   Size=30 nt.     Delta G=-18.90 kcal/mol
Antiterminator: Size=41 nt.     Delta G= -7.36 kcal/mol
Anti-antiterminator:   Size=27 nt.     Delta G= -8.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TACAACATCTGATGAAATCCTTCAAGAACTGGTTAACCTTAAACGTTAAggagggaggggaggc
gagtaatcgcttctccgctgttttatgattaaagtaacccgtttgaacgggcagccctttacactgaatgcgctatttattgaacagattgaatgttttc
cggatactacaattactctgtcaaatggtaagaagtttgtagtaaaagaagatgaagaagctgttctggaaaagatcgcagctttctaccgaaaaataca
aatatttgcaatggatcaaggaatagaggaaccggaATG

    fliL --- fliM --- fliY --- cheY --- fliZ --- fliP --- fliQ --- fliR --- flhB --- flhA --- flhF --- ylxH --- cheB --- cheA --- cheW --- cheC --- cheD --- sigD --- ylxL Gene: fliL     GI: 16078693     BI number: BSU16300     GOG: COG1580     Description: flagellar protein Gene: fliM     GI: 16078694     BI number: BSU16310     GOG: COG1868     Description: flagellar motor switch protein Gene: fliY     GI: 16078695     BI number: BSU16320     GOG: COG1776,COG1886     Description: flagellar motor switch protein Gene: cheY     GI: 16078696     BI number: BSU16330     GOG: COG0784     Description: two-component response regulator Gene: fliZ     GI: 16078697     BI number: BSU16340     GOG: COG3190     Description: flagellar protein Gene: fliP     GI: 16078698     BI number: BSU16350     GOG: COG1338     Description: flagellar protein Gene: fliQ     GI: 16078699     BI number: BSU16360     GOG: COG1987     Description: flagellar protein Gene: fliR     GI: 16078700     BI number: BSU16370     GOG: COG1684     Description: flagellar protein Gene: flhB     GI: 16078701     BI number: BSU16380     GOG: COG1377     Description: flagella-associated protein Gene: flhA     GI: 16078702     BI number: BSU16390     GOG: COG1298     Description: flagella-associated protein Gene: flhF     GI: 16078703     BI number: BSU16400     GOG: COG1419     Description: flagella-associated protein Gene: ylxH     GI: 16078704     BI number: BSU16410     GOG: COG0455     Description: - Gene: cheB     GI: 16078705     BI number: BSU16420     GOG: COG2201     Description: methyl-accepting chemotaxis proteins (MCP)-glutamate methylesterase and two-component response regulator-like Gene: cheA     GI: 16078706     BI number: BSU16430     GOG: COG0643     Description: two-component sensor histidine kinase Gene: cheW     GI: 16078707     BI number: BSU16440     GOG: COG0835     Description: - Gene: cheC     GI: 16078708     BI number: BSU16450     GOG: COG1776     Description: - Gene: cheD     GI: 16078709     BI number: BSU16460     GOG: COG1871     Description: - Gene: sigD     GI: 16078710     BI number: BSU16470     GOG: COG1191     Description: RNA polymerase sigma-28 factor (sigma-D) Gene: ylxL     GI: 16078711     BI number: BSU16480     GOG: NOG47626     Description:             A           T  A           T  g           G  g           C  a           A  g   T       A  g       ta A  G      A  g      g  a a  A       Ta        at gC        Tg        gc gT        Cg        cg cG        Cg        gc cG       A  g       gt aT       A  a       at aT        Tg        gc |  A       Tg        gt |  A       Gc        gc gC       G  g       gc gC        Ta       a  g aT        Cg        gc gT        At        gt                         gttttatgattaaagtaacccgtttgaacgggcagccctttacactgaatgcgctatttattgaacagattgaatgttttccggatactacaattactctgtcaaatggtaagaagtttgtagtaaaagaagatgaagaagctgttctggaaaagatcgcagctttctaccgaaaaatacaaatatttgcaatggatcaaggaatagaggaaccggaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [N] COG1580 Flagellar basal body-associated protein ... can be seen here [N] COG1868 Flagellar motor switch protein ... can be seen here [NT] COG1776 Chemotaxis protein CheC, inhibitor of MCP methylation ... can be seen here [NU] COG1886 Flagellar motor switch/type III secretory pathway protein ... can be seen here [T] COG0784 FOG: CheY-like receiver ... can be seen here [N] COG3190 Flagellar biogenesis protein ... can be seen here [NU] COG1338 Flagellar biosynthesis pathway, component FliP ... can be seen here [NU] COG1987 Flagellar biosynthesis pathway, component FliQ ... can be seen here [NU] COG1684 Flagellar biosynthesis pathway, component FliR ... can be seen here [NU] COG1377 Flagellar biosynthesis pathway, component FlhB ... can be seen here [NU] COG1298 Flagellar biosynthesis pathway, component FlhA ... can be seen here [N] COG1419 Flagellar GTP-binding protein ... can be seen here [D] COG0455 ATPases involved in chromosome partitioning ... can be seen here [NT] COG2201 Chemotaxis response regulator containing a CheY-like receiver domain and a methylesterase domain ... can be seen here [NT] COG0643 Chemotaxis protein histidine kinase and related kinases ... can be seen here [NT] COG0835 Chemotaxis signal transduction protein ... can be seen here [NT] COG1776 Chemotaxis protein CheC, inhibitor of MCP methylation ... can be seen here [NT] COG1871 Chemotaxis protein; stimulates methylation of MCP proteins ... can be seen here [K] COG1191 DNA-directed RNA polymerase specialized sigma subunit ... can be seen here     ..................................................................................................................