                                                                        Gene putatively regulated by attenuation in B_subtilis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:131 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-10.90 kcal/mol
Antiterminator: Size=34 nt.     Delta G= -4.00 kcal/mol
Anti-antiterminator:   Size=39 nt.     Delta G= -3.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AAAAGAATTATCCGGCATCCCGATCATCGCAAATATAAATGCCGGACATACCTCGCCA
ATTGCCACGTTCCCTATAGGAGGAACATGCAGGATTGAAGCTATTTCGGGTACATCAC
GAATATGGATTGATAAACATTAAtcagcttgtaaatttttttacaagcttttttagcgcaatcggctatgcatgccgcacgag
acatgacaaatgtcatataggaggcatgatgtgtgctactacaaaagacttctctcattagcgtatactgaaccgagacacacaatgagaggatacttac
tATG

    des Gene: des     GI: 16078978     BI number: BSU19180     GOG: COG3239     Description: fatty acid desaturas   C A  A T  T G  C       AA G  A      A  C GC        TA CG        AT TA        GT TA        TA |  T       TA        tt TA        At       t  t AT        Gc        at TG       G  a       at CG       T  g       at G  A      A  c       ta A  |      T  |       gc AT       A  |       ta GT        At        ta TG        Gt        cg TA        Cg        gc AT        At        at                         tttttagcgcaatcggctatgcatgccgcacgagacatgacaaatgtcatataggaggcatgatgtgtgctactacaaaagacttctctcattagcgtatactgaaccgagacacacaatgagaggatacttactATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [I] COG3239 Fatty acid desaturase ... can be seen here     ..................................................................................................................