                                                                        Gene putatively regulated by attenuation in B_subtilis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:26 nt.     Distance to run of Ts=0 nt.   Size=21 nt.     Delta G=-14.50 kcal/mol
Antiterminator: Size=44 nt.     Delta G=-11.50 kcal/mol
Anti-antiterminator:   Size=79 nt.     Delta G=-13.14 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTCTGCTGATACGTCAATCGTCTTCTGAAGGAAATCCATCTGACCTCAGACGCCAGCT
TGTTTTTGCAAAAGAGCTGGGCGTACCGGTTTCAAAAGTCAATTTGATCAACGGAGAT
ACACTTCAAAATGTCATCGTAAAAGAAGTTCTGACTGATTTGGTTATTTTCCAAAACC
CGTTAAATAACACGAGATCTCATGTTTCACTCTCAAGTGTTGTAAGCTGGGGTGCTTT
TTAAatgatgacagaggctctgcttgctgcggagccgtttttatgtttgacggcgggaggcggtatagATG

    cgeD --- cgeE Gene: cgeD     GI: 16079034     BI number: BSU19760     GOG: COG0463     Description: - Gene: cgeE     GI: 16079033     BI number: BSU19750     GOG: COG0454     Description:   G T  T A  T C  T T  C C  A T  C AT GC AT GC |  A |  A CG AT CG AT AT TG AT         t A  A      a  g A  |      A  a TA        At TG        Tg GC        Ta |  T      |  c |  G       Ta CG        Tg CG        Ta CG        Cg AT       G  | |  G       Tg A  C       Gc         g A  T       Gt       t  c A  T       Gc       t  t C  T       Gt        cg C  T      T  |       gc T  T       Cg        tg TA        Gc        cg TA        At        ta Ta        At        cg At        Tg        gc Tg        Gc        gc                         gtttttatgtttgacggcgggaggcggtatagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG0463 Glycosyltransferases involved in cell wall biogenesis ... can be seen here [KR] COG0454 Histone acetyltransferase HPA2 and related acetyltransferases ... can be seen here     ..................................................................................................................