                                                                        Gene putatively regulated by attenuation in B_subtilis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:0 nt.     Distance to run of Ts=0 nt.   Size=39 nt.     Delta G=-14.90 kcal/mol
Antiterminator: Size=63 nt.     Delta G= -5.18 kcal/mol
Anti-antiterminator:   Size=43 nt.     Delta G= -5.73 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ACAATCATTACAACAAAGCCTAATGAGCTTATGGAAGACATCCATGATCGGATGCCGG
TTATCCTTACTGATGAGAACGAAAAGGAATGGCTCAACCCTAAAAATACTGATCCTGA
TTATCTACAAAGCTTACTGCAGCCATATGATGCTGATGACATGGAAGCATACCAGGTT
TCATCTTTAGTGAATTCACCTAAAAACAATTCACCTGAGCTCATTGAATCCCATTAAg
taccactgccatatcgctttatatatcaccttcgcttagctaatatgttctaagtaggaggtgatattTTG

    ligB Gene: ligB     GI: 16079109     BI number: BSU20500     GOG: COG1793     Description: DNA ligas            gc           t  c           c  a           a  t           c  a           c  t           a  c            tg            gc            At            At   C       T  t A  A      T  a A  A      A  t       ta A  T      C  a      a  t A  T      C  t      a  g A  C      C  a      t  t T  A      T  |      c  t C  C      A  |       gc C  C       At        at AT        Gc        ta CG        Ta        ta TA       |  c       cg TG       T  c       gt A  C      A  t      |  a AT       C  t       cg GC       T  c       tg TA        Cg        ta GT        Gc        cg AT        At        cg TG        Gt        at TA        Ta        cg TA        Cg        ta                         tattTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG1793 ATP-dependent DNA ligase ... can be seen here     ..................................................................................................................