                                                                        Gene putatively regulated by attenuation in B_subtilis

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:139 nt.    Distance to gene:26 nt.     Distance to run of Ts=0 nt.   Size=40 nt.     Delta G=-22.30 kcal/mol
Antiterminator:    Distance from promoter:123 nt. Size=24 nt.     Delta G= -5.50 kcal/mol
Anti-antiterminator:    Distance from promoter:85 nt.    Size=45 nt.     Delta G= -6.93 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAAC-tactgt. It has a score value of 69.61 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAACTCTAAaattggcgactttactgtcaatgagcttgagcaaattaaaaatgaatgtgtaagacttcatttaaattatggactcggaat
ccctctaactaagaaaatccacaatcttttccatgaaatttatggaacatccaacaataatgagattcaattcaacgagtttcgaaatcgctatgaaaat
ggtgaattcgaggctctttttaattagaaattaaggagatgtttttATG

    blyA Gene: blyA     GI: 16079200     BI number: BSU21410     GOG: COG5632     Description: N-acetylmuramoyl-L-alanine amidas   a a  t at gt ta at cg cg ta ta |  c                 aa |  a                g  a |  t                 ta |  c                 at |  c                 tg |  a                 cg |  a                 gt |  c                 cg |  a       tc        ta |  a      t  a      a  a |  t      a  a       at |  a      a  c       at |  a       cg        gc |  t       ta        cg tg        tg        ta ta        at        tg cg        gt        tg ta        at        gc at        gc        at at        tg        gc                         tttttaattagaaattaaggagatgtttttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG5632 N-acetylmuramoyl-L-alanine amidase ... can be seen here     ..................................................................................................................