Gene putatively regulated by attenuation in B_subtilis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:27 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G=-13.40 kcal/mol
Antiterminator: Size=68 nt.     Delta G=-12.20 kcal/mol
Anti-antiterminator:   Size=41 nt.     Delta G= -6.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGAAAAATCAAAATTGTCGGTGTATCAAGCGCTGCAATCGTAATGGACAAGCCTGATC
GAAATAGTTCTAAAAATATTGGCACAGTTAAGCTTGGAAGCACTATTTCAATTTCTGG
TTCAGTTAAAGGTAAAAACAATTCCAATGGCTACTGGGAAGTTATTTATAAAGGTAAA
CGTGGATATATCTCGGGACAGTTTGGATCAACAATCTAAttatattcaattttctcggaggatgtttattg
atcaatatgtttcagtaaatatccttttctatggtactaaggtggtgaacattttATG

    bhlA --- bhlB


Gene: bhlA     GI: 16079201     BI number: BSU21420     GOG: -------     Description: holin-like protein
Gene: bhlB     GI: 16079202     BI number: BSU21430     GOG: NOG09437     Description: holin-like protei


            A
          A  C
          C  A
           TA
           AT
           GC
           GT
           TA
          |  A
          |  t
          |  t
          |  a
          |  t
          |  a
          |  t
          |  t
          |  c
           Ta
           Ta
 GT        Gt
G  A       At
A  A      C  t
A  A       At        ta
A  C       Gc       a  t
 TG        Gt       a  g
 AT        Gc       c  t
 TG        Cg       t  t
 TG       T  |       at
 TA        Cg        gc
 AT        Ta        ta
 TA       |  g       tg
T  T      A  g       at
G  A       Ta        ta
A  |       At        ta
 AT        Tg        ta
 GC        At        gt
 GT        Gt        ta
 GC        Gt        at
 TG        Ta        gc
 CG        Gt        gc
                        ttttctatggtactaaggtggtgaacattttATG


    ..................................................................................................................