                                                                        Gene putatively regulated by attenuation in B_subtilis

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:114 nt.    Distance to gene:94 nt.     Distance to run of Ts=0 nt.   Size=37 nt.     Delta G=-12.30 kcal/mol
Antiterminator:    Distance from promoter:65 nt. Size=56 nt.     Delta G= -7.10 kcal/mol
Anti-antiterminator:    Distance from promoter:45 nt.    Size=50 nt.     Delta G= -4.24 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAAA-CACTAT. It has a score value of 70.28 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAAATGTATTGAGTTTTGGTGCACTATTCATcaattggctccttttggttctaattggtttcattatatcatgc
cttttggttgaaaacaccctttattttacgatcatcttttttcttggctctgcaggataatggttgaacagaagttaccacaagatgtggtggacatagt
ctgtatttttttaattattaaataaaaataattgtcttattttttgaatattcatgttataatggcatattaaatagggatttaaaacaagaaaggaatc
tgtacATG

    ilvA Gene: ilvA     GI: 16079236     BI number: BSU21770     GOG: COG1171     Description: threonine dehydratas            tc   c       c  t c  t      g  g c  t       gc a  t       ta c  a       tg at        cg at        ta at       t  t at       t  a |  a      t  |        g gc       t  |      a  a tg       t  |      a  t ta       c  |       cg gt        ta        at gc        at        cg ta        cg        cg |  t       tg        at |  c       at        tg |  t       gt        tg |  t       cg       |  a |  t      a  |      |  c |  t       ta       |  a |  t       ta       |  t |  t      t  c      g  a t  c      t  a      a  g t  t      a  |       at t  t       tg        gc cg        ta        at cg        ta        cg gc        cg        at                         atttttttaattattaaataaaaataattgtcttattttttgaatattcatgttataatggcatattaaatagggatttaaaacaagaaaggaatctgtacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG1171 Threonine dehydratase ... can be seen here     ..................................................................................................................