                                                                        Gene putatively regulated by attenuation in B_subtilis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:50 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G=-13.50 kcal/mol
Antiterminator: Size=39 nt.     Delta G= -4.30 kcal/mol
Anti-antiterminator:   Size=39 nt.     Delta G= -3.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGGAAAATCTGCTGATTGTTGCTTGCTCAGTGGGATTGGGGCTCGGTGTGACCGTTGT
GCCGGATATTTTCAAACAGCTTCCGAGTGCCTTAACGCTGCTTACAACGAATGGCATT
GTGGCGGGCAGCTTTACTGCAGTCGTCTTAAATATTGTATATAACGTTTTTTCTAAAG
CTAAAAAAATAGAACAAGAAGCTGACCTCGCTGAACAAAAAACAGCAGTCTAActccgccg
cggcggagttttttttgcatataaaaaagattgttgcggcacaatgtatgcaaagaggtgatcgcATG

    bcsA --- ypbQ Gene: bcsA     GI: 16079263     BI number: BSU22050     GOG: COG3424     Description: naringenin-chalcone synthase Gene: ypbQ     GI: 16079262     BI number: BSU22040     GOG: COG1755     Description:             A AA       A  A A  A      C  A A  A      A  A AT       A  A TA        GC CG        TA G  A       CG A  A       GC A  C      C  A A  A      T  | TA       C  |       gc CG        CG       c  g TA        AT        cg TA        GC        gc TG       T  T       cg |  C      C  A       cg T  T      G  A       ta TG       A  c       cg TA        At        At GC        Gc        At                         ttttttgcatataaaaaagattgttgcggcacaatgtatgcaaagaggtgatcgcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [Q] COG3424 Predicted naringenin-chalcone synthase ... can be seen here [S] COG1755 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................