                                                                        Gene putatively regulated by attenuation in B_subtilis

This operon is putativelly rgulated by Guanine_G-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:95 nt.    Distance to gene:23 nt.     Distance to run of Ts=0 nt.   Size=35 nt.     Delta G=-22.60 kcal/mol
Antiterminator:    Distance from promoter:52 nt. Size=57 nt.     Delta G=-19.11 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttacaa-tataat. It has a score value of 72.29 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttacaatataataggaacactcatataatcgcgtggatatggcacgcaagtttctaccgggcaccgtaaatgtccgactatgggtgagcaatggaaccgc
acgtgtacggttttttgtgatatcagcattgcttgctctttatttgagcgggcaatgctttttttattctcataacggaggtagacaggATG

    xpt --- pbuX Gene: xpt     GI: 16079265     BI number: BSU22070     GOG: COG0503     Description: xanthine phosphoribosyltransferase Gene: pbuX     GI: 16079264     BI number: BSU22060     GOG: COG2233     Description: xanthine permeas gt c  g a  t c  a gc cg cg at at gt |  t |  t |  t |  g |  t |  g |  a |  t        a |  a      t  t |  t      t  t |  c      t  t |  a       cg |  g       ta gc        cg ta        gc at        tg at        tg cg        cg gc        gc at        ta g  t       ta t  g       at gc        cg gt        gc gc        at             ttttttattctcataacggaggtagacaggATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [F] COG0503 Adenine/guanine phosphoribosyltransferases and related PRPP-binding proteins ... can be seen here [F] COG2233 Xanthine/uracil permeases ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Guanine_G-box sequence ... can be seen here     ..................................................................................................................