                                                                        Gene putatively regulated by attenuation in B_subtilis

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:162 nt.    Distance to gene:46 nt.     Distance to run of Ts=0 nt.   Size=18 nt.     Delta G= -9.70 kcal/mol
Antiterminator:    Distance from promoter:111 nt. Size=55 nt.     Delta G= -4.63 kcal/mol
Anti-antiterminator:    Distance from promoter:56 nt.    Size=63 nt.     Delta G=-25.40 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TGGATT-TATGCT. It has a score value of 64.26 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGGATTCTGACGCTTATAAATGGTATGCTGAACTTAGAAAATATGGATCAGTTCCTCA
TTCCGGCTTCGGCCTTGGATTAGAGCGGACAGTAGCTTGGATCAGCGGAGCGCCTCAC
GTTCGTGAAACGATTCCGTTCCCAAGACTGTTAAACCGTCTGTATCCGTAAtacattcaaat
gaaacaaaaaagagtctcctgcaagggagactttttacagtaaaggggcaatcacaatcctttacagtaagaggtgtgacgATG

    dnaD --- nth --- ypoC Gene: dnaD     GI: 16079292     BI number: BSU22350     GOG: COG3935     Description: - Gene: nth     GI: 16079291     BI number: BSU22340     GOG: COG0177     Description: endonuclease III Gene: ypoC     GI: 16079290     BI number: BSU22330     GOG: NOG14761     Description: TT G  C CG         G AT       C  T CG       C  A TA        TA C  A       At C  A       Ta GC        Gc CG        Ta |  A      |  t GT       |  t AT       |  c GC       |  a GC       |  a CG       |  a GT       |  t AT        Cg C  C       Ta T  |      |  a A  |      G  a GC       C  c GC       C  a TA       A  a TA       A  a CG       A  a       ca G  |       Ta       g  a A  |       Ta        tg TA       G  g       cg GC        Ta        cg AT        Cg        ta CG        At        cg AT        Gc        ta GT        At        gc                         tttttacagtaaaggggcaatcacaatcctttacagtaagaggtgtgacgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG3935 Putative primosome component and related proteins ... can be seen here [L] COG0177 Predicted EndoIII-related endonuclease ... can be seen here     ..................................................................................................................