                                                                        Gene putatively regulated by attenuation in B_subtilis

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:96 nt.    Distance to gene:14 nt.     Distance to run of Ts=1 nt.   Size=37 nt.     Delta G=-12.60 kcal/mol
Antiterminator:    Distance from promoter:38 nt. Size=71 nt.     Delta G=-19.50 kcal/mol
Anti-antiterminator:    Distance from promoter:5 nt.    Size=64 nt.     Delta G=-22.80 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAAA-TAGAAA. It has a score value of 61.58 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAAAGAATCAAGCGTTTTGTAGAAAAACATAGCTAAcagatcaaaaagcggctgacagaaaagccgcttt
ttatctgcattgacccggttagttaagagcgggtataataaagtgatgataaaagagttcgcggggcaatgagcttccgaatgtctttcttgttttggag
ggaaatatgTTG

    asnS Gene: asnS     GI: 16079293     BI number: BSU22360     GOG: COG0017     Description: asparaginyl-tRNA synthetas            tt           g  a           a  a ag        tg c  a       ta a  a      g  g g  a       gc ta        cg cg        cg gc        cg gc        at cg       |  a gc       |  t at       |  a at       |  a at       |  t at       |  a at       g  a c  |       ta ta        tg at        at gc        cg         t at       g  a      a  g |  g      t  t      a  a |  c       cg        cg |  a       ta        gc |  t       at        gt |  t       ta        gt |  g       ta        gc |  a       ta       c  | |  c       ta        gc |  c       tg        cg |  c      |  a       ta |  g      |  g       ta cg       |  t       gt At       |  t      |  g At       |  c       at Ta        cg        gc Cg        gc        at Gt        cg        at At        cg        at                         cttgttttggagggaaatatgTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0017 Aspartyl/asparaginyl-tRNA synthetases ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_subtilis                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:107 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G=-12.00 kcal/mol Antiterminator: Size=48 nt.     Delta G= -3.57 kcal/mol Anti-antiterminator:   Size=55 nt.     Delta G= -7.74 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ATTTGTTAAAGCGCTTCTCGAGGAGGAAAAAGTTGCGATTGTTCCAGGATCCGGATTT GGCTCTCCTGAGAATGTCCGTCTTTCTTATGCAACATCGTTAGATCTTCTTGAAGAAG CCATTGAAAGAATCAAGCGTTTTGTAGAAAAACATAGCTAAcagatcaaaaagcggctgacagaaaagcc gctttttatctgcattgacccggttagttaagagcgggtataataaagtgatgataaaagagttcgcggggcaatgagcttccgaatgtctttcttgttt tggagggaaatatgTTG     asnS Gene: asnS     GI: 16079293     BI number: BSU22360     GOG: COG0017     Description: asparaginyl-tRNA synthetas GC A  C A  A G  T A  T A  G       AG G  A      T  C TA       A  T TA       C  A CG       A  A TA       A  c T  |      A  a C  |      A  g TA       A  a AT       G  t GC       A  c A  A      T  a TA       G  a TG        Ta        ag GC        Ta       c  a CG        Ta       a  a T  T       Tg       g  a A  T       Gc        ta C  |       Cg        cg AT       G  g       gc AT       A  c       gc CG        At        cg GT        Cg        gc TA        Ta        at                         ttttatctgcattgacccggttagttaagagcgggtataataaagtgatgataaaagagttcgcggggcaatgagcttccgaatgtctttcttgttttggagggaaatatgTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0017 Aspartyl/asparaginyl-tRNA synthetases ... can be seen here     ..................................................................................................................