                                                                        Gene putatively regulated by attenuation in B_subtilis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:94 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G=-12.70 kcal/mol
Antiterminator: Size=43 nt.     Delta G= -4.70 kcal/mol
Anti-antiterminator:   Size=42 nt.     Delta G=-11.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTTAAACGGTGCAGCCGCACGCCTTGTGCAGGAAGGAGATAAGGTCATTATTATTTCC
TACAAAATGATGTCTGATCAAGAAGCGGCAAGCCATGAGCCGAAAGTGGCTGTTCTGA
ATGATCAAAACAAAATTGAACAAATGCTGGGGAACGAACCAGCCCGTACAATTTTGTA
Gaagaaaagccccctttatcgggggttttcttttaagattttgagagtaaaacggttttgccgctccatttccgtacaaaacgtgttacacttttgtcgt
atgcaagaattgaggtgtccattttaATG

    dinG Gene: dinG     GI: 16079297     BI number: BSU22400     GOG: COG0847,COG1199     Description: ATP-dependent helicas            TT           A  T AC        AT A  G       CG G  A       AT G  A       TA GC       G  G GC       C  a TA       C  a CG       C  g GC       G  a T  C      A  a A  C      C  a A  |      C  a       ta A  |      A  g      t  t CG       A  |      t  c AT       G  |       cg A  A      C  |       cg GC       A  |       cg TA       A  |       cg TA        Gc        cg AT        Gc        gt AT        Gc        at AT        Gc        at                         tcttttaagattttgagagtaaaacggttttgccgctccatttccgtacaaaacgtgttacacttttgtcgtatgcaagaattgaggtgtccattttaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG0847 DNA polymerase III, epsilon subunit and related 3'-5' exonucleases ... can be seen here [KL] COG1199 Rad3-related DNA helicases ... can be seen here     ..................................................................................................................