                                                                        Gene putatively regulated by attenuation in B_subtilis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:26 nt.     Distance to run of Ts=0 nt.   Size=37 nt.     Delta G=-12.60 kcal/mol
Antiterminator: Size=47 nt.     Delta G= -9.50 kcal/mol
Anti-antiterminator:   Size=52 nt.     Delta G=-13.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CAGACGGACTTTTTTTCCATTGCTGATAAAGGCGGGGACTACGCCAAAAATGTCGGCC
GCTGGATGCTTGATCCTGATGACGTGGCAGCTCAAATTACAGCTGCAATTTTTACGAA
AAAGCGGGAGATCAATCTTCCGCGTTTAATGAATGCCGGCACTAAGCTGTATCAGCTG
TTTCCAGCTCTTGTAGAAAAGCTGGCAGGACGCGCGCTCATGAAAAAATAAtgatagaactg
cctgtggtggagtggcttgtttctcacggggcagtttttgatagtggaagggagagattgttgaATG

    dsdA Gene: dsdA     GI: 16079434     BI number: BSU23770     GOG: COG3048     Description: D-serine dehydratas TA        ct G  G      a  g TA       a  c TA        gc C  A       at TA        tg CG        at GC       g  g AT        tg CG        At         c CG       A  g      g  t T  |      T  |      g  t T  |      A  |      t  g T  |      A  |       gt GC       A  |       at TA       A  |       gt CG       A  |       gc G  |      A  |      t  | A  |      G  |       gt CG       T  |       gc TA       A  |       ta A  C       Cg        gc T  G       Ta       |  g GC        Cg        tg TG        Gt        cg |  C       Cg        cg CG       G  |       gc GC        Cg        ta AT        Gc        cg                         tttttgatagtggaagggagagattgttgaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG3048 D-serine dehydratase ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_subtilis                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:189 nt.     Distance to run of Ts=1 nt.   Size=20 nt.     Delta G= -7.60 kcal/mol Antiterminator: Size=42 nt.     Delta G= -8.60 kcal/mol Anti-antiterminator:   Size=49 nt.     Delta G=-17.20 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case CAGACGGACTTTTTTTCCATTGCTGATAAAGGCGGGGACTACGCCAAAAATGTCGGCC GCTGGATGCTTGATCCTGATGACGTGGCAGCTCAAATTACAGCTGCAATTTTTACGAA AAAGCGGGAGATCAATCTTCCGCGTTTAATGAATGCCGGCACTAAGCTGTATCAGCTG TTTCCAGCTCTTGTAGAAAAGCTGGCAGGACGCGCGCTCATGAAAAAATAAtgatagaactg cctgtggtggagtggcttgtttctcacggggcagtttttgatagtggaagggagagattgttgaATG     dsdA Gene: dsdA     GI: 16079434     BI number: BSU23770     GOG: COG3048     Description: D-serine dehydratas   A G  C G  T        T G  A      C  T GC       G  G CG        TA GC        AT GC        GC |  A       GC |  A      |  T |  A      |  G A  A      |  A A  A      |  T AT       |  G TG       |  A AT       T  C GC        CG TG        GT        AT CG        CG       A  T GC        CG       A  A |  C       GC       C  C T  G      |  A       TA T  C      G  G       CG AT       C  C       GC CG       T  T       AT CG        GC        CG TA        TA        GC                         AATTTTTACGAAAAAGCGGGAGATCAATCTTCCGCGTTTAATGAATGCCGGCACTAAGCTGTATCAGCTGTTTCCAGCTCTTGTAGAAAAGCTGGCAGGACGCGCGCTCATGAAAAAATAAtgatagaactgcctgtggtggagtggcttgtttctcacggggcagtttttgatagtggaagggagagattgttgaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG3048 D-serine dehydratase ... can be seen here     ..................................................................................................................