                                                                        Gene putatively regulated by attenuation in B_subtilis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:74 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-10.20 kcal/mol
Antiterminator: Size=67 nt.     Delta G= -4.27 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTCTGCCGCTGAAGGCTATATCTGTAAAGGCTTGTCATTTTCTCCAATCACGGGAGGA
GACGGAAATATTGAGTTTCTCCTTCAGTTTGCATTGGCCGGGAGAGGGACAGGAAGGC
CAGGAACTGCCGGAAGAAGAGATCATGCGCGTTGTAGAAGAAGCACATAAgacgttaaaagaa
aaaaaagcagatgtaccggaataatagggcgctattattccttttttctgcattcatgtacaatgtgcagagaatcatataacataaaagaacagataag
cttggaaatagaggtgcttacATG

    ahrC --- recN Gene: ahrC     GI: 16079481     BI number: BSU24250     GOG: COG1438     Description: transcriptional regulator Gene: recN     GI: 16079480     BI number: BSU24240     GOG: COG0497     Description: aa g  a a  a a  a a  a a  a ta tg gc c  a a  g g  | A  | A  | Ta At Cg At C  a G  c A  c A  g G  g A  a       gc A  a      g  g G  t       gc A  a       at Ta        ta Gt        at Ta        at Tg        ta G  g       at Cg        at Gc        gc Cg        gc             ttttttctgcattcatgtacaatgtgcagagaatcatataacataaaagaacagataagcttggaaatagaggtgcttacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG1438 Arginine repressor ... can be seen here [L] COG0497 ATPase involved in DNA repair ... can be seen here     ..................................................................................................................