                                                                        Gene putatively regulated by attenuation in B_subtilis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:117 nt.     Distance to run of Ts=0 nt.   Size=19 nt.     Delta G=-12.80 kcal/mol
Antiterminator: Size=45 nt.     Delta G= -6.60 kcal/mol
Anti-antiterminator:   Size=43 nt.     Delta G= -9.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGTTAATGCTGAAGGAGATAAAATCAATATTACAGTCAAATCAGACAAACACTCTAAA
TCGAAGGCGACAGCCATTATAGACCTTGTGGCAAAAGAAATCAAAACAATGAAAGATG
TCGCTGTCACATTTGAACCCTCTAAATAAgaatgagggaaaaaagcccgctaaacaagcgggctttttgcgttgctgtc
atattagagttgaattcacaagtccgctcctgtaagatgaacatagtatgtacttttagtagtaacctataaaaaaagaaatttcatacataggagtgcg
attgtATG

    accB --- accC --- yqhY Gene: accB     GI: 16079491     BI number: BSU24350     GOG: COG0511     Description: acetyl-CoA carboxylase subunit (biotin carboxyl carrier subunit) Gene: accC     GI: 16079490     BI number: BSU24340     GOG: COG0439     Description: acetyl-CoA carboxylase subunit (biotin carboxylase subunit) Gene: yqhY     GI: 16079489     BI number: BSU24330     GOG: COG1302     Description:             A AA       T  A C  T      A  g A  G      A  a A  A      A  a A  A      T  t A  A       Cg CG        Ta TA        Cg AT        Cg A  G       Cg AT       A  a GC       A  a A  G      G  a        a A  C       Ta       a  c A  |       Ta       a  a AT        Ta        ta CG       A  g       cg GT       C  c       gc GC       A  c       cg TA       C  c       cg GC        Tg        cg TA        Gc        gc                         tttttgcgttgctgtcatattagagttgaattcacaagtccgctcctgtaagatgaacatagtatgtacttttagtagtaacctataaaaaaagaaatttcatacataggagtgcgattgtATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [I] COG0511 Biotin carboxyl carrier protein ... can be seen here [I] COG0439 Biotin carboxylase ... can be seen here [S] COG1302 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................