Gene putatively regulated by attenuation in B_subtilis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:166 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-16.10 kcal/mol

                                                                        Nomenclature/Definitions

tcttgaaaatgaccaaatgaccggtattgttgcattaggcgatctttccgttgagaaagatactggtcaataagcgaaaacagcataatgaaaatggaat
ctagcaggcatggtgaccatgtctgcttttttatttatagggaaaattataatgacaggggtacattcagttgaaagtcttttttcttgccagaaagaat
tggtttttcagcatataacatctcacaaaatcacgttttccctgtttgattaccttttcttctttttctacaatatgcgttgaaaggagagggaatcaaa
TTG

    comGA --- comGB --- comGC --- comGD --- comGE --- comGF --- comGG


Gene: comGA     GI: 16079529     BI number: BSU24730     GOG: COG2804     Description: -
Gene: comGB     GI: 16079528     BI number: BSU24720     GOG: COG1459     Description: probably part of the DNA transport machinery
Gene: comGC     GI: 16079527     BI number: BSU24710     GOG: COG4537     Description: -
Gene: comGD     GI: 16079526     BI number: BSU24700     GOG: COG2165     Description: probably part of the DNA transport machinery
Gene: comGE     GI: 16079525     BI number: BSU24690     GOG: -------     Description: probably part of the DNA transport machinery
Gene: comGF     GI: 16079524     BI number: BSU24680     GOG: COG4940     Description: probably part of the DNA transport machinery
Gene: comGG     GI: 16079523     BI number: BSU24670     GOG: -------     Description: probably part of the DNA transport machiner


           g
         t  a
          gc
          gc
          ta
          at
          cg
          gt
          gc
          at
          cg
          gc
          at
            tttttatttatagggaaaattataatgacaggggtacattcagttgaaagtcttttttcttgccagaaagaattggtttttcagcatataacatctcacaaaatcacgttttccctgtttgattaccttttcttctttttctacaatatgcgttgaaaggagagggaatcaaaTTG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[NU] COG2804 Type II secretory pathway, ATPase PulE/Tfp pilus assembly pathway, ATPase PilB ... can be seen here
[NU] COG1459 Type II secretory pathway, component PulF ... can be seen here
[U] COG4537 Competence protein ComGC ... can be seen here
[NU] COG2165 Type II secretory pathway, pseudopilin PulG ... can be seen here
[U] COG4940 Competence protein ComGF ... can be seen here

    ..................................................................................................................