                                                                        Gene putatively regulated by attenuation in B_subtilis

This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:97 nt.    Distance to gene:45 nt.     Distance to run of Ts=3 nt.   Size=35 nt.     Delta G=-18.80 kcal/mol
Antiterminator:    Distance from promoter:67 nt. Size=45 nt.     Delta G=-14.51 kcal/mol
Anti-antiterminator:    Distance from promoter:76 nt.    Size=10 nt.     Delta G= -1.20 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: atgaaa-taagct. It has a score value of 60.91 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
The T-box sequence: agggtggaaccgcg is shown in italic-bold style

atgaaagcgaccttagggcggtgtaagctaaggatgagcacgcaacgaaaggcattcttgagcaattttaaaaaagaggctgggattttgttctcagcaa
ctagggtggaaccgcgggagaactctcgtccctatgtttgcggctggcaagcatagagacgggagttttttggttgctgccgcagtcaacttatgaaaga
aaagtggaggtgcttgaaATG

    glyQ --- glyS Gene: glyQ     GI: 16079581     BI number: BSU25270     GOG: COG0752     Description: glycyl-tRNA synthetase (alpha subunit) Gene: glyS     GI: 16079580     BI number: BSU25260     GOG: COG0751     Description: glycyl-tRNA synthetase (beta subunit            aa           g  c            at            gc            gt            gc            cg            gt           c  |           c  |        c           a  |      g  t           a  |      g  g           g  |       cg           g  |       gc           t  |       ta            gc        ta            gc        tg            gc        gc            at        ta            ta        at           |  t       ta            cg        cg aa        at       c  a g  c      |  t       cg gc        at        ta tg        cg        gc gc        gc        cg                         ggagttttttggttgctgccgcagtcaacttatgaaagaaaagtggaggtgcttgaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0752 Glycyl-tRNA synthetase, alpha subunit ... can be seen here [J] COG0751 Glycyl-tRNA synthetase, beta subunit ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here     ..................................................................................................................