                                                                        Gene putatively regulated by attenuation in B_subtilis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:85 nt.     Distance to run of Ts=0 nt.   Size=37 nt.     Delta G=-19.00 kcal/mol
Antiterminator: Size=32 nt.     Delta G= -6.90 kcal/mol
Anti-antiterminator:   Size=18 nt.     Delta G= -3.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CACAGCAAGCTCAAGGCGGAGCAAACGCTGAAGGCAAAGCGGATGACAACGTTGTCGA
CGCTGAATACGAAGAAGTAAACGACGACCAAAACAAAAAATAAgttctttttagtgtcagccccgctt
ccggagctgaccgaaaagaacacatttcataatctgattcaatgattagaaagtcaaagtcaggcatctcttggctttgactttttttcttgcccgggat
aaaaggaattgaaaaatcataattcaaaatgatacaatctaatttatgtgagaaattcgggagagtgaagcgagATG

    dnaJ --- yqeT --- yqeU --- yqeV Gene: dnaJ     GI: 16079600     BI number: BSU25460     GOG: COG0484     Description: heat-shock protein Gene: yqeT     GI: 16079599     BI number: BSU25450     GOG: COG2264     Description: - Gene: yqeU     GI: 16079598     BI number: BSU25440     GOG: COG1385     Description: - Gene: yqeV     GI: 16079597     BI number: BSU25430     GOG: COG0621     Description:                       t                     a  c            ga       c  t           a  a       gc            ta        gt            tg        at            at        cg            gc        tg            ta        gc           a  a       at aa       a  |       at c  t      c  |       at tg        ta        cg ta        tg        ta at        at        gc gt        gc        at ta        ta        at cg        cg        at ta        tg        gt                         tttcttgcccgggataaaaggaattgaaaaatcataattcaaaatgatacaatctaatttatgtgagaaattcgggagagtgaagcgagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [O] COG0484 DnaJ-class molecular chaperone with C-terminal Zn finger domain ... can be seen here [J] COG2264 Ribosomal protein L11 methylase ... can be seen here [S] COG1385 Uncharacterized protein conserved in bacteria ... can be seen here [J] COG0621 2-methylthioadenine synthetase ... can be seen here     ..................................................................................................................