                                                                        Gene putatively regulated by attenuation in B_subtilis

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:136 nt.    Distance to gene:28 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-16.40 kcal/mol
Antiterminator:    Distance from promoter:130 nt. Size=14 nt.     Delta G= -3.50 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAAC-TACCGT. It has a score value of 61.58 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAACGGTGTCTTAACCTTTGGTACCGTTCTTTTTTATATCGCTAATGAAGGTTTGT
CAATAACTGAAAACTTAGCACAGATTGGTGTTAAAATACCATCATCAATAACAGATCG
ATTACAAACAATTGAGAACGAAAAAGAACAGAGTAAGAATAACGCAGACAAAGCTGCT
GGCTAAgccagtggctttttttatcttactgacagaaggagagagggtatATG

    cwlA Gene: cwlA     GI: 16079643     BI number: BSU25900     GOG: COG3409,COG5632     Description: N-acetylmuramoyl-L-alanine amidas             A           T  A            Cg            Gc            Gc            Ta            Cg AA       G  t C  A      T  g A  G       Cg GC        Gc AT        At CG        At GC        At             ttttatcttactgacagaaggagagagggtatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG3409 Putative peptidoglycan-binding domain-containing protein ... can be seen here [M] COG5632 N-acetylmuramoyl-L-alanine amidase ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_subtilis                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:187 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-10.40 kcal/mol Antiterminator: Size=38 nt.     Delta G= -4.50 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ATGGTTTGGCTATGTCCGCAAGCTACTCAATTTCTTTGCGGTCATTTTAGCAAACGTG ATTGATACAGTACTCAATTTGAACGGTGTCTTAACCTTTGGTACCGTTCTTTTTTATA TCGCTAATGAAGGTTTGTCAATAACTGAAAACTTAGCACAGATTGGTGTTAAAATACC ATCATCAATAACAGATCGATTACAAACAATTGAGAACGAAAAAGAACAGAGTAAGAAT AACGCAGACAAAGCTGCTGGCTAAgccagtggctttttttatcttactgacagaaggagagagggtatATG     cwlA Gene: cwlA     GI: 16079643     BI number: BSU25900     GOG: COG3409,COG5632     Description: N-acetylmuramoyl-L-alanine amidas AG C  T A  A T  C AT GC TA        CC TA       A  T AT       A  T GT       T  T |  T       TG |  G       CG |  A      T  | TA        GT GC        TA CG        GC A  G       GC A  |       CG AT        AT CG        AT GT        GC             TTTTTTATATCGCTAATGAAGGTTTGTCAATAACTGAAAACTTAGCACAGATTGGTGTTAAAATACCATCATCAATAACAGATCGATTACAAACAATTGAGAACGAAAAAGAACAGAGTAAGAATAACGCAGACAAAGCTGCTGGCTAAgccagtggctttttttatcttactgacagaaggagagagggtatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG3409 Putative peptidoglycan-binding domain-containing protein ... can be seen here [M] COG5632 N-acetylmuramoyl-L-alanine amidase ... can be seen here     ..................................................................................................................