                                                                        Gene putatively regulated by attenuation in B_subtilis

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:137 nt.    Distance to gene:84 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-10.30 kcal/mol
Antiterminator:    Distance from promoter:91 nt. Size=63 nt.     Delta G= -6.30 kcal/mol
Anti-antiterminator:    Distance from promoter:72 nt.    Size=50 nt.     Delta G= -3.90 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgaat-ttgatt. It has a score value of 60.91 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgaatactaccctcaaatgcttgattgaagaaaaggatagagaaactagggtagcggagcaaaccatgtgtttgctccgcttttttatgtttataaaag
aataattaaggaggtattgtggatttctataaaaatattttgacatttcagtaaagagcagatatatttatatatgaacacatgctcatatataaatatt
atttgtatcatgttagaatgcttcataacagatttgaaataataaatacatatgtattaaaaactttaggtaaggaggagttttttATG

    czcD Gene: czcD     GI: 16079718     BI number: BSU26650     GOG: COG1230     Description: cation-efflux system membrane protei            ag           c  t            ta            ta            ta           a  g           c  a           a  g            gc tt        ta a  t       tg gc        ta gt       |  t ta        ta gt        at ta        ta ta        at a  a       at        ca t  a       at       a  t g  a      a  a      c  g g  t       at       a  c a  a       ta        at gt        at        gc gt        ta        ta at       |  t       at at        cg        ta tg        ta        at ta        ta        ta a  c      t  |       at a  a      a  |       ta t  t      g  |       ta at        gc        ta at        ta        at gc        gc        ta                         ttatttgtatcatgttagaatgcttcataacagatttgaaataataaatacatatgtattaaaaactttaggtaaggaggagttttttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG1230 Co/Zn/Cd efflux system component ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_subtilis                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:199 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-19.90 kcal/mol                                                                         Nomenclature/Definitions CAGGTAAATTGTAGttgaatactaccctcaaatgcttgattgaagaaaaggatagagaaactagggtagcggagcaaaccatgtgtttgc tccgcttttttatgtttataaaagaataattaaggaggtattgtggatttctataaaaatattttgacatttcagtaaagagcagatatatttatatatg aacacatgctcatatataaatattatttgtatcatgttagaatgcttcataacagatttgaaataataaatacatatgtattaaaaactttaggtaagga ggagttttttATG     czcD Gene: czcD     GI: 16079718     BI number: BSU26650     GOG: COG1230     Description: cation-efflux system membrane protei            t          a  g          c  t           cg           at           at           at           cg           gc           at           gc           gc           cg           gc           at             tttttatgtttataaaagaataattaaggaggtattgtggatttctataaaaatattttgacatttcagtaaagagcagatatatttatatatgaacacatgctcatatataaatattatttgtatcatgttagaatgcttcataacagatttgaaataataaatacatatgtattaaaaactttaggtaaggaggagttttttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG1230 Co/Zn/Cd efflux system component ... can be seen here     ..................................................................................................................