                                                                        Gene putatively regulated by attenuation in B_subtilis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:126 nt.     Distance to run of Ts=0 nt.   Size=35 nt.     Delta G=-16.00 kcal/mol
Antiterminator: Size=46 nt.     Delta G= -4.90 kcal/mol
Anti-antiterminator:   Size=40 nt.     Delta G=-11.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GAGCGAACATTAGCCCCTTATGAAGAAAAGCTCGGACTTCGCATAAGTGATGATGAAA
AATTATTTATAGCCGCCATATTTGCTGAAGAAGTGCATGGCCAGCTGTTTTAAaaacagtt
ttttcatatgaacctgtattaaatggaacaccattttaatacaggtttatttttttcgttttaagtgtttcaacaacaaattgctattggctgaaataac
aatgaaaacgcttaacacaactgtgttggcacgatccttgcattatatatggatgtacaaaacaggaaaggagcaatagatATG

    levD --- levE --- levF --- levG Gene: levD     GI: 16079761     BI number: BSU27070     GOG: COG2893     Description: phosphotransferase system (PTS) fructose-specific enzyme IIA component Gene: levE     GI: 16079760     BI number: BSU27060     GOG: COG3444     Description: phosphotransferase system (PTS) fructose-specific enzyme IIB component Gene: levF     GI: 16079759     BI number: BSU27050     GOG: COG3715     Description: phosphotransferase system (PTS) fructose-specific enzyme IIC component Gene: levG     GI: 16079758     BI number: BSU27040     GOG: COG3716     Description: phosphotransferase system (PTS) fructose-specific enzyme IID componen             a           c  t           t  a   A       t  t A  G       tg G  A       ta TA        ta CG       t  c       ac GT        gc       a  a TG        at        gc T  C       cg        gc T  |       at        ta A  |      a  a      |  t TA        at        at AT        At        at CG       |  a       at CG       |  a       ta GC       |  a       ta |  C       At        at C  A       Tg        ta CG        Tg        gc GC        Ta        ta AT        Ta        cg TG        Gc        cg AT        Ta        at                         ttatttttttcgttttaagtgtttcaacaacaaattgctattggctgaaataacaatgaaaacgcttaacacaactgtgttggcacgatccttgcattatatatggatgtacaaaacaggaaaggagcaatagatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG2893 Phosphotransferase system, mannose/fructose-specific component IIA ... can be seen here [G] COG3444 Phosphotransferase system, mannose/fructose/N-acetylgalactosamine-specific component IIB ... can be seen here [G] COG3715 Phosphotransferase system, mannose/fructose/N-acetylgalactosamine-specific component IIC ... can be seen here [G] COG3716 Phosphotransferase system, mannose/fructose/N-acetylgalactosamine-specific component IID ... can be seen here     ..................................................................................................................