                                                                        Gene putatively regulated by attenuation in B_subtilis

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:143 nt.    Distance to gene:60 nt.     Distance to run of Ts=1 nt.   Size=32 nt.     Delta G=-10.60 kcal/mol
Antiterminator:    Distance from promoter:110 nt. Size=47 nt.     Delta G= -4.77 kcal/mol
Anti-antiterminator:    Distance from promoter:71 nt.    Size=56 nt.     Delta G= -7.20 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAAC-taccat. It has a score value of 80.32 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAACAAAACGCGATTTTGTAAtaccatagcatagacataaataactctgaccatattatgtataggcaggaagggaatgtg
cgaattcccttctttccctgtttataaacgcgaaatatttgcagaacgacacgattcagtttaagataaacagtacctatatgggagagaagaacgagga
ctgccctgtgttctcattcttgtattttttagtttatgctctcatacataatcgaagatgttgagggacaaccagaaggagtgaagggacATG

    greA --- yrrR Gene: greA     GI: 16079786     BI number: BSU27320     GOG: COG0782     Description: transcription elongation factor Gene: yrrR     GI: 16079785     BI number: BSU27310     GOG: COG0768     Description:   g a  a c  a gc tg ta |  c t  a        t a  c      a  a t  g      t  t a  a       cg at        cg at       a  g gc       t  a c  a      g  g g  |      a  a       cc cg       c  g      c  t at       a  a      g  g at       a  a      t  t at       a  g       cg ta       t  a       at |  a      a  a       gt |  g      g  c       gc |  a      a  g       at at       a  a       gc ta        tg       c  a ta        tg        at ta        ta        at gc        gc        gc ta        at        at cg        cg        at                         gtattttttagtttatgctctcatacataatcgaagatgttgagggacaaccagaaggagtgaagggacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG0782 Transcription elongation factor ... can be seen here [M] COG0768 Cell division protein FtsI/penicillin-binding protein 2 ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_subtilis                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:177 nt.     Distance to run of Ts=0 nt.   Size=18 nt.     Delta G= -7.00 kcal/mol Antiterminator: Size=46 nt.     Delta G= -4.72 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TGATGGTCACAAAAATTCAAACCATTCTTGAACAAAACGCGATTTTGTAAtaccatagcatag acataaataactctgaccatattatgtataggcaggaagggaatgtgcgaattcccttctttccctgtttataaacgcgaaatatttgcagaacgacacg attcagtttaagataaacagtacctatatgggagagaagaacgaggactgccctgtgttctcattcttgtattttttagtttatgctctcatacataatc gaagatgttgagggacaaccagaaggagtgaagggacATG     greA --- yrrR Gene: greA     GI: 16079786     BI number: BSU27320     GOG: COG0782     Description: transcription elongation factor Gene: yrrR     GI: 16079785     BI number: BSU27310     GOG: COG0768     Description:   a t  t tg at ta at |  a cg cg a  | gc ta cg tg c  a a  a a  g       gc t  g      t  g a  g      g  a a  a       ta a  |       at ta        at at        gc cg        gc at        gc             ttctttccctgtttataaacgcgaaatatttgcagaacgacacgattcagtttaagataaacagtacctatatgggagagaagaacgaggactgccctgtgttctcattcttgtattttttagtttatgctctcatacataatcgaagatgttgagggacaaccagaaggagtgaagggacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG0782 Transcription elongation factor ... can be seen here [M] COG0768 Cell division protein FtsI/penicillin-binding protein 2 ... can be seen here     ..................................................................................................................