                                                                        Gene putatively regulated by attenuation in B_subtilis

This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:43 nt.     Distance to run of Ts=3 nt.   Size=35 nt.     Delta G=-18.40 kcal/mol
Antiterminator: Size=47 nt.     Delta G=-13.41 kcal/mol
Anti-antiterminator:   Size=10 nt.     Delta G= -1.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
The T-box sequence: agggtggtaccgcg is shown in italic-bold style

gtagaatacatacgaatctcgagtgacggatctgagtacgccgaagccctgttaaagagagaagctccataagctgaaaggagctttatcagaagatcgg
aggaagctaatcctgagtgcagttaatcactgccgcttatcctgcgttacagggttaaaggtgacgggcgcatgaatgcccgtaatcagggtggtaccgcgagacagctctcgtccctgtgtaaacgttggtttgcatagggggagggcttttttgctgtcactgaagagaatttcgatttttatagaggaggaaataca
ATG

    alaS Gene: alaS     GI: 16079794     BI number: BSU27410     GOG: COG0013     Description: alanyl-tRNA synthetas            ag           c  c            at            gc            at            gc            cg            gt           c  |           c  |           a  |       tt           t  |      g  g           g  |       cg           g  |       at           t  |       at            gc        at            gc        tg            gc        gc            at        ta            cg        gt           |  t       ta           |  g       cg           t  t       cg ta       a  a       cg g  c      a  a       tg gc        ta       g  | tg        gc        cg gc        cg        ta                         gggcttttttgctgtcactgaagagaatttcgatttttatagaggaggaaatacaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0013 Alanyl-tRNA synthetase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here     ..................................................................................................................