                                                                        Gene putatively regulated by attenuation in B_subtilis

This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:60 nt.     Distance to run of Ts=0 nt.   Size=39 nt.     Delta G=-27.30 kcal/mol
Antiterminator: Size=34 nt.     Delta G= -8.21 kcal/mol
Anti-antiterminator:   Size=53 nt.     Delta G=-10.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
The T-box sequence: agggtggcaccacg is shown in italic-bold style

gtaggtcagattgcatgattagagaggaacccgccccaggctgaaagcggatcccattgcgtctttctcgaaacaacactccggaggtttcctgctgaac
gcgtgaataacgccattaggcagtgaacgtgaacctgcgttaaaggatcgagcgggaatatgaacgtattccaactagggtggcaccacgggtataactc
tcgtccctactatcatgtatagtaggggcgggagtttttttcattttcatcattaacgatcattggatattttataaggaatacataaggaggtctacct
ATG

    hisS --- aspS Gene: hisS     GI: 16079810     BI number: BSU27560     GOG: COG0124     Description: histidyl-tRNA synthetase Gene: aspS     GI: 16079809     BI number: BSU27550     GOG: COG0173     Description: aspartyl-tRNA synthetas aa g  c tg at ta at at         a gc       t  a        t gc       a  c      a  g g  a      t  t      c  t c  a       gc        ta gc        gt        at at        gc        ta |  a       cg        cg g  g       at        at cg       c  |       ta tg       c  |       cg at       a  |       cg g  g      c  |       cg g  g      g  |       tg a  c      g  |       gc a  a      t  |       cg a  c       gc        tg t  c       gc        cg ta        gc        ta gc        at        cg cg        ta        at                         ttttttcattttcatcattaacgatcattggatattttataaggaatacataaggaggtctacctATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0124 Histidyl-tRNA synthetase ... can be seen here [J] COG0173 Aspartyl-tRNA synthetase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here     ..................................................................................................................