                                                                        Gene putatively regulated by attenuation in B_subtilis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:189 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G=-10.50 kcal/mol
Antiterminator: Size=36 nt.     Delta G= -6.80 kcal/mol
Anti-antiterminator:   Size=33 nt.     Delta G= -7.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGAGTTTCTATGCCAATGACGAACCAGCCTTCTGTAAACCAAATGTTTGGCCGTCCGG
AAGAAGAAAATGAGTGAtcgttcggaacgatgtaaatcgttcctttttttgttttcaagcagatcactgccaaatggagagaactgac
acgcttaacatgccccccatacgcacatgataaaagcgagcaaacatgctcaattcgtccacggggggtttttccattgggtaaaaaaatgacgatcgct
agcctgattctaatgacagccggcttaacagcatgcggagcaaacgataatgctATG

    coxA Gene: coxA     GI: 16079835     BI number: BSU27830     GOG: -------     Description: spore cortex protei            TG           G  A            At            Gc            Tg            At TG       A  | A  T      A  | AT       A  | AT       G  | CG       A  | CG       A  | |  C      G  | A  C      A  |       ta A  G      A  |      g  a A  T       Gt        ta T  C       Gc        at GC        Cg        gc TG        Cg        cg CG       |  a       at TA        Ta        at TA        Gc        gc CG        Cg        gc                         tttttttgttttcaagcagatcactgccaaatggagagaactgacacgcttaacatgccccccatacgcacatgataaaagcgagcaaacatgctcaattcgtccacggggggtttttccattgggtaaaaaaatgacgatcgctagcctgattctaatgacagccggcttaacagcatgcggagcaaacgataatgctATG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_subtilis                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:196 nt.     Distance to run of Ts=0 nt.   Size=18 nt.     Delta G= -7.20 kcal/mol Antiterminator: Size=36 nt.     Delta G= -6.80 kcal/mol Anti-antiterminator:   Size=33 nt.     Delta G= -7.00 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case GGAGTTTCTATGCCAATGACGAACCAGCCTTCTGTAAACCAAATGTTTGGCCGTCCGG AAGAAGAAAATGAGTGAtcgttcggaacgatgtaaatcgttcctttttttgttttcaagcagatcactgccaaatggagagaactgac acgcttaacatgccccccatacgcacatgataaaagcgagcaaacatgctcaattcgtccacggggggtttttccattgggtaaaaaaatgacgatcgct agcctgattctaatgacagccggcttaacagcatgcggagcaaacgataatgctATG     coxA Gene: coxA     GI: 16079835     BI number: BSU27830     GOG: -------     Description: spore cortex protei            AA           G  A            AA            AT            GG            AA TG       A  | A  T      G  | AT       G  | AT       C  | CG       C  | CG       T  | |  C      G  | A  C      C  | A  G      C  |       ta A  T       GG       g  a T  C       GT        ta GC        TG        at TG        TA        gc CG       |  t       cg TA        Tc        at TA        Gg        at CG        Tt        gc                         ctttttttgttttcaagcagatcactgccaaatggagagaactgacacgcttaacatgccccccatacgcacatgataaaagcgagcaaacatgctcaattcgtccacggggggtttttccattgggtaaaaaaatgacgatcgctagcctgattctaatgacagccggcttaacagcatgcggagcaaacgataatgctATG     ..................................................................................................................