                                                                        Gene putatively regulated by attenuation in B_subtilis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:17 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G=-17.20 kcal/mol
Antiterminator: Size=16 nt.     Delta G= -3.90 kcal/mol
Anti-antiterminator:   Size=70 nt.     Delta G=-13.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ACGATGGAAAATGAAGAAGTGCCATTTAACATTACACGCGATCCAGACGGTGTATTTG
TGCTTTCAGGAGACAGCCTTGAGCGGTTATTCAAGATGACTGATTTCTCACGTGATGA
ATCGGTTAAACGGTTTGCAAGACAGATGCGCGGAATGGGTGTTGATGAAGCACTCAGA
GAACGCGGAGCCAAGGATGGAGATATAATCAGGCTTCTGGAATTTGAATTTGAATTTA
TTGATTAAtcaatgttggctgaaaagagagcctggtgccaggctctctattttaaaggggggatgcaaATG

    pheB --- pheA Gene: pheB     GI: 16079843     BI number: BSU27910     GOG: COG4492     Description: chorismate mutase Gene: pheA     GI: 16079842     BI number: BSU27900     GOG: COG0077     Description: prephenate dehydratas AA G  T G  T T  T CG TA TA C  | GT GT AT CG TA A  A A  T T  T AT TA AT GT |  G |  A A  T G  T G  A TA At Gc                  tg |  a                g  c |  a                 gc |  t       aa        ta G  g      a  g       cg At       a  a       cg At       g  g       gc Cg        ta        at Cg        cg        gc Gc        gc        at At        gc        gc                         tattttaaaggggggatgcaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG4492 ACT domain-containing protein ... can be seen here [E] COG0077 Prephenate dehydratase ... can be seen here     ..................................................................................................................