                                                                        Gene putatively regulated by attenuation in B_subtilis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:93 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-15.70 kcal/mol
Antiterminator: Size=77 nt.     Delta G=-15.72 kcal/mol
Anti-antiterminator:   Size=67 nt.     Delta G= -8.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CAAAAGATCTCTATGATGCAAGTGAAATCAGCAATAAAAGCTGGAGTGAAGATCCAGA
CGATGTAATCAAATTCATAGAAAGTAAAAAGGGCTCAAATGAAATTGTGCTGATTACC
GGATCTCTTTACTTTATTTCTGACATTCGAAAAAGGTTGAAATAAaagcatccggctccggcagaat
caaaaaaagattctgccgtttttttcatgtgtaaaattgaatattcccaattggagctcaggatgtccattttgctacaatccataccagaactcaatga
gtaaaggtgtgttgtctATG

    comC Gene: comC     GI: 16079859     BI number: BSU28070     GOG: COG1989     Description: DNA-binding protei             A GA       G  A T  A      C  A A  A      T  A AT       T  A AT       A  G CG        CG T  T       AT CG        GT GC       T  | GT        CG |  G       TA |  A       TA |  T       TA |  T       AT |  A       TA |  C       TA |  C       Ta |  G      |  a |  G      C  g |  A      A  c |  T      T  a GC       T  t AT       T  c A  C      C  c AT        Tg AT        Cg AT       T  c        a TA        At       a  a GC        Gc       a  a AT        Gc       a  a AT        Cg        cg AT        Cg        ta |  A      |  c       at |  T      |  a       at G  T      A  g       gc A  T       Ta        at T  C       Ta        cg AT        At        gc CG        Gc        gc TA        Ta        cg                         tttttttcatgtgtaaaattgaatattcccaattggagctcaggatgtccattttgctacaatccataccagaactcaatgagtaaaggtgtgttgtctATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [NOU] COG1989 Type II secretory pathway, prepilin signal peptidase PulO and related peptidases ... can be seen here     ..................................................................................................................