                                                                        Gene putatively regulated by attenuation in B_subtilis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:106 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-23.50 kcal/mol
Antiterminator: Size=58 nt.     Delta G= -8.19 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCATCATGCTTGATGTGATGTTTGAGCTGCCTTCTCGTGATGACATTGAAAAATGTGT
AATCACCGGGGCAACTGTGACACACGGAGAGCCTCCTCGCCTCTTATTAAAAGACGGC
ACTGAGGTAAGCCAAGATAAAACATCTGCATAAagataagcacaaacctcctgagtggtaacactcaggaggtttt
tttgcatgcaactcttccggaaaaacgtttattcccgtcttctatgggagatactagcaatcagaggaatgaattggatacataaattgtttttcaggag
ggaccaccATG

    lonB Gene: lonB     GI: 16079873     BI number: BSU28210     GOG: COG1067     Description: Lon-like ATP-dependent proteas AT C  A G  A Ta Cg Ta At C  a A  a A  g A  c A  a T  c A  a G  a A  a A  c       ta C  c      g  a C  t       gc G  |       ta A  |       gc A  |       at T  |       gc Gc        ta Gc        cg At        cg G  g       ta Ta        cg Cg        cg At        at Cg        at             tttttgcatgcaactcttccggaaaaacgtttattcccgtcttctatgggagatactagcaatcagaggaatgaattggatacataaattgtttttcaggagggaccaccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [O] COG1067 Predicted ATP-dependent protease ... can be seen here     ..................................................................................................................