Gene putatively regulated by attenuation in B_subtilis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:24 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-14.10 kcal/mol
Antiterminator: Size=36 nt.     Delta G= -4.47 kcal/mol
Anti-antiterminator:   Size=40 nt.     Delta G= -8.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGGGCCTGCACCGATGTCGCAAGTCCGCCTGTTTAACGCGCATCCGACAGGCGCCATG
AATAAATCTGAACGATTAGAAGCATTAATGGATGAAGGCGGCCTTGCAGATTGCGGCA
ACTCGCAAAACTGTGTTCAATCCTGTCCGAAGGGGATTCCGCTTACCACTTCGATTGC
AGCCTTGAATAGAGATACAAACTTACAAGCGTTCCGCAATTTCTTCGGAAGCGACAGA
GTATAAtgtaagaaaaaacctcttccgcatgggagaggtttttttaaacaataaggagatgaaaaaagATG

    gerE


Gene: ysmA     GI: 16079894     BI number: BSU28420     GOG: COG0824     Description:


 TT
T  C
 AT
 AT        aa
C  |      t  g
 GC       g  a
 CG       t  a
 CG       A  a
 TA       A  a
 TA       T  a       ca
G  |      A  a      g  t
 CG       T  c       cg
 GC        Gc        cg
A  G       At        tg
A  A       Gc        ta
C  C       At        cg
A  A      C  t       ta
 TG       A  c       cg
 TA        Gc        cg
 CG        Cg        at
 AT        Gc        at
                        tttttaaacaataaggagatgaaaaaagATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[R] COG0824 Predicted thioesterase ... can be seen here

    ..................................................................................................................