                                                                        Gene putatively regulated by attenuation in B_subtilis

This operon is putativelly rgulated by Lysine_riboswitch

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:61 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-16.50 kcal/mol
Antiterminator: Size=42 nt.     Delta G= -8.80 kcal/mol
Anti-antiterminator:   Size=70 nt.     Delta G=-17.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

agatagaggtgcgaacttcaagagtatgcctttggagaaagatggattctGTGAAAAAGGCTGAAAGGGGAGCGTCGCC
GAAGCAAATAAAACCCCATCGGTATTATTTGCTGGCCGTGCATTGAataaatgtaaggctgtcaag
aaatcattttcttggagggctatctcgttgttcataatcatttatgatgattaattgataagcaatgagagtattcctctcattgctttttttattgtgg
acaaagcgctctttctcctcacccgcacgaaccaaaatgtaaagggtggtaatacATG

    lysC Gene: lysC     GI: 16079899     BI number: BSU28470     GOG: COG0527     Description: aspartokinase II alpha subunit (aa 1->408) and beta subunit (aa 246->408 ca t  t at at at gc at at cg tg |  a g  g tg         a cg       t  t gc        tg gt        ta a  a       at a  t       cg t  c       ta g  t       at t  c       at a  g       ta         t at       |  a      a  t at       |  t      t  c tg        at        gc at        cg        at At        ta        gc Gc       |  t       at Ta       |  a       gc |  t      |  a       ta T  a       tg        at A  a       gc        at C  t       ta        cg Gc        ta        gc Ta        gt        at Gt        cg        at                         tttttattgtggacaaagcgctctttctcctcacccgcacgaaccaaaatgtaaagggtggtaatacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0527 Aspartokinases ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Lysine_riboswitch sequence ... can be seen here     ..................................................................................................................