                                                                        Gene putatively regulated by attenuation in B_subtilis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:57 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-13.40 kcal/mol
Antiterminator: Size=41 nt.     Delta G= -3.80 kcal/mol
Anti-antiterminator:   Size=70 nt.     Delta G=-14.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GACTCCGCGGTTTAAAATTGATCAGGAAATCGAAAATGATAACCGGGCTGTCGGCTTT
ATTTCATTTGTCATTTCTGTCGGGCTTTCTTTTGTGGTGGCAGCCGGAATATAAggggac
ggagaatagatggaaaagcttgcgaaaatactgctcgccgcagcgggaatctttttgttaattggtcttatatatctgttcatattatgagaaaaagaaa
gatttacctttctttttcttttttttgccgtccatctgctataatgataaggtggatctctaaaatcgaaaggggaggttttATG

    lcfA Gene: lcfA     GI: 16079908     BI number: BSU28560     GOG: COG0318     Description: long chain acyl-CoA synthetas gc c  a cg gc cg tg cg g  a t  a c  t a  c t  | at at         t at       a  t at        ta gt        at cg        cg gt        ta |  t       tg |  a      |  a |  a      |  a |  t      |  a       tt t  t      g  a      t  a tg        ta       a  c cg        cg        gc |  t       ta        at gc       a  |       at at       t  |       at at       a  |       gc a  a      t  |       at a  t      a  |       at g  a       ta        at gt        ta        at ta        cg        at at        ta        gc gc        gt        at at        gt        gt                         ttttttgccgtccatctgctataatgataaggtggatctctaaaatcgaaaggggaggttttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [IQ] COG0318 Acyl-CoA synthetases (AMP-forming)/AMP-acid ligases II ... can be seen here     ..................................................................................................................