                                                                        Gene putatively regulated by attenuation in B_subtilis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:146 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G=-13.00 kcal/mol
Antiterminator: Size=43 nt.     Delta G=-15.80 kcal/mol
Anti-antiterminator:   Size=53 nt.     Delta G=-21.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGAGGCCAGGATATTGTGAACGGAAACATTCTTGTTCGCCATGCCTATGATGCCAATG
ACAACGGCATTCCAAGCTTCTCATCAATGATTTGAattggagctcgggctggccgtcctattgaataaaaagcc
gggctctgcccccggctttttttaaaagaaaagattgacagtataatagtcaattactataataaaattgttcgtacaaaatatttatttataggtttat
tttcctatcattagtacgtatcttttgtatttgaaagcgttttattttatgagaaaggggcagtttacATG

    araA --- araB --- araD --- araL --- araM --- araN --- araP --- araQ --- abfA Gene: araA     GI: 16079932     BI number: BSU28800     GOG: COG2160     Description: L-arabinose isomerase Gene: araB     GI: 16079931     BI number: BSU28790     GOG: COG1069     Description: L-ribulokinase Gene: araD     GI: 16079930     BI number: BSU28780     GOG: COG0235     Description: L-ribulose-5-phosphate 4-epimerase Gene: araL     GI: 16079929     BI number: BSU28770     GOG: COG0647     Description: - Gene: araM     GI: 16079928     BI number: BSU28760     GOG: COG0371     Description: - Gene: araN     GI: 16079927     BI number: BSU28750     GOG: COG1653     Description: sugar-binding protein Gene: araP     GI: 16079926     BI number: BSU28740     GOG: COG1175     Description: integral membrane protein Gene: araQ     GI: 16079925     BI number: BSU28730     GOG: COG0395     Description: integral membrane protein Gene: abfA     GI: 16079924     BI number: BSU28720     GOG: COG3534     Description: alpha-L-arabinofuranosidas GA T  T AT AT CG         a TA       t  t A  a      c  t C  t       cg T  t       ta Cg       |  a Tg       g  t Ta       c  a Cg       c  a Gc       g  a At       g  a A  c       ta         t Cg        cg       c  g Cg       g  |      t  c Tg        gc       c  c |  c       gc        gc T  t       cg        gc A  g       tg        gc Cg        cg        cg Gc        gc        cg Gc        at        gc Cg        gc        at At        gt        at                         tttttaaaagaaaagattgacagtataatagtcaattactataataaaattgttcgtacaaaatatttatttataggtttattttcctatcattagtacgtatcttttgtatttgaaagcgttttattttatgagaaaggggcagtttacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG2160 L-arabinose isomerase ... can be seen here [C] COG1069 Ribulose kinase ... can be seen here [G] COG0235 Ribulose-5-phosphate 4-epimerase and related epimerases and aldolases ... can be seen here [G] COG0647 Predicted sugar phosphatases of the HAD superfamily ... can be seen here [C] COG0371 Glycerol dehydrogenase and related enzymes ... can be seen here [G] COG1653 ABC-type sugar transport system, periplasmic component ... can be seen here [G] COG1175 ABC-type sugar transport systems, permease components ... can be seen here [G] COG0395 ABC-type sugar transport system, permease component ... can be seen here [G] COG3534 Alpha-L-arabinofuranosidase ... can be seen here     ..................................................................................................................