                                                                        Gene putatively regulated by attenuation in B_subtilis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:153 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-16.00 kcal/mol
Antiterminator: Size=30 nt.     Delta G= -3.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGGCCATGCTGCATCGTGATGATTATGAAAACGCGGTAAAGTTAATTACAGAAGTCAT
TAAGAAGTTAGACCGAAAAACGGTTGACGAAATTACGTACCAATAAagatacggaagaatccgcct
attgaggtggattctatttttttgtctgtacaaattacagcatagtgactacaataaaggggataccgaaaatttcctgaacatgacgatatacgatacg
cagtcgatttgacaggaagggaggataaataatctaatttgtaagcgctttctaaaataaaggaggttgaacaaaaTTG

    abnA Gene: abnA     GI: 16079933     BI number: BSU28810     GOG: COG3507     Description: arabinan-endo 1,5-alpha-L-arabinas ga a  a at gc gc        tt cg       a  g a  c       ta t  c       cg a  |       cg g  |       gt a  |       cg A  |       cg At        ta Ta        at At        at At        gc Cg        at             atttttttgtctgtacaaattacagcatagtgactacaataaaggggataccgaaaatttcctgaacatgacgatatacgatacgcagtcgatttgacaggaagggaggataaataatctaatttgtaagcgctttctaaaataaaggaggttgaacaaaaTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG3507 Beta-xylosidase ... can be seen here     ..................................................................................................................