                                                                        Gene putatively regulated by attenuation in B_subtilis

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:111 nt.    Distance to gene:63 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-16.50 kcal/mol
Antiterminator:    Distance from promoter:80 nt. Size=40 nt.     Delta G= -5.90 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGACT-TAGAAT. It has a score value of 87.68 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGACTAAAGATCCGGTATTGTGTAGAATAGTTATTGAATTGAATGTAAATCACAAGC
AGAAGCACccgcttctcacctgattgacacatgcatgtagttggcaggttgaccgtacatttttattgatacagatgttcgtagtgtgggtgtt
ttataatgcccacactttttgtttgcctgcaaaatgcattcaaaatgagttgtgaatcaattcgaagaaactatggaggtggctcATT

    infC --- rpmI --- rplT --- ysdA Gene: infC     GI: 16079939     BI number: BSU28870     GOG: COG0290     Description: initiation factor IF-3 Gene: rpmI     GI: 16079938     BI number: BSU28860     GOG: COG0291     Description: ribosomal protein L35 Gene: rplT     GI: 16079937     BI number: BSU28850     GOG: COG0292     Description: ribosomal protein L20 Gene: ysdA     GI: 16079936     BI number: BSU28840     GOG: COG3326     Description: ga a  t cg at t  | at gc tg t  t a  |       ta t  |      t  t t  |       ta t  |       ta ta        gt tg        tg at        gc cg        gc at        gc tg        ta g  |       gc cg        ta cg        gc at        at             ttttgtttgcctgcaaaatgcattcaaaatgagttgtgaatcaattcgaagaaactatggaggtggctcATT                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0290 Translation initiation factor 3 (IF-3) ... can be seen here [J] COG0291 Ribosomal protein L35 ... can be seen here [J] COG0292 Ribosomal protein L20 ... can be seen here [S] COG3326 Predicted membrane protein ... can be seen here     ..................................................................................................................