                                                                        Gene putatively regulated by attenuation in B_subtilis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:167 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-17.40 kcal/mol
Antiterminator: Size=76 nt.     Delta G=-17.96 kcal/mol
Anti-antiterminator:   Size=48 nt.     Delta G=-12.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTTGGGGAGCGAATCATATTAACAGAGTGTACGGGGATACATTTTCTGTGCTAGAAGA
AAGTGTGCTCAATGATAAGTTAAAACAGGAATCATAAagcatgagggcagtcagtgcggagcgctggctgctt
tttggttcttacgcctgatattctgtgcaagaaaacataagatgcatcataaattagcgttataatcgttgatttttatcaatatgtactggcgaatttg
ttttaatgtgttatactaattttagatagtaacaaattaggatggcataattgataaggggtgtccaacATG

    gapB Gene: gapB     GI: 16079954     BI number: BSU29020     GOG: COG0057     Description: glyceraldehyde-3-phosphate dehydrogenas            AA           A  A           T  C           T  A           G  G           A  G           A  A            TA            AT            GC            TA            AT           A  A           C  A CT        Ta G  A       Cg T  G       Gc G  A       Ta TA        Gt CG        Tg TA       |  a TA       G  g TA       A  g TG       A  g AT       A  c CG       G  a AT       A  g        g TG        At       g  a A  |       Gc        cg GC       A  |       gc GT        Ta        tg GC        Cg        gc |  A      G  t       at G  A      T  g       cg C  T       Gc        tg A  G       Tg        gc TA        Cg        at GT        Ta        cg TA        Tg        gc                         tttttggttcttacgcctgatattctgtgcaagaaaacataagatgcatcataaattagcgttataatcgttgatttttatcaatatgtactggcgaatttgttttaatgtgttatactaattttagatagtaacaaattaggatggcataattgataaggggtgtccaacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG0057 Glyceraldehyde-3-phosphate dehydrogenase/erythrose-4-phosphate dehydrogenase ... can be seen here     ..................................................................................................................