                                                                        Gene putatively regulated by attenuation in B_subtilis

This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:89 nt.     Distance to run of Ts=0 nt.   Size=35 nt.     Delta G=-20.40 kcal/mol
Antiterminator: Size=40 nt.     Delta G=-13.31 kcal/mol
Anti-antiterminator:   Size=44 nt.     Delta G=-20.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
The T-box sequence: agggtggtaccgcg is shown in italic-bold style

aagaaacagatattgttgcagagagttgacggctggtgaaagtcaatcaagtttgtttccgaactcacctcagagttgcagcggtgaaaagccgctgacg
cataactgcgttaaaagtatcaagtgagtgcggcgtatgccgcgctaacgagggtggtaccgcgggaaaacgaaagtctctcgtccctttttgggatgag
ggagttttttttagtttgggaatattctgaatataatcctctccttcccgtcaatacttgaaccatacacgccgtattcaatcagaaggaggtttttact
TTG

    leuS Gene: leuS     GI: 16080084     BI number: BSU30320     GOG: COG0495     Description: leucyl-tRNA synthetas ta        aa g  t      g  a cg        cg gc        at gc       a  c cg       a  | gc        at         t tg        gc       t  t gc        gt       t  t at        gc        cg g  a       cg        cg ta        gt        cg gc       c  |       ta |  g      c  |       gt |  a      a  |       cg |  g      t  |       ta |  g      g  |       cg a  g      g  |       tg at       t  |       cg cg        gc        ta tg        gc       g  g at        gc        at ta        at        at gc        gt        at                         tttttagtttgggaatattctgaatataatcctctccttcccgtcaatacttgaaccatacacgccgtattcaatcagaaggaggtttttactTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0495 Leucyl-tRNA synthetase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here     ..................................................................................................................