                                                                        Gene putatively regulated by attenuation in B_subtilis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:192 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-14.00 kcal/mol
Antiterminator: Size=39 nt.     Delta G= -9.30 kcal/mol
Anti-antiterminator:   Size=17 nt.     Delta G= -6.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGTTGGTCAAGCGGTTAAGACACCGCCCTTTCACGGCGGTAACACGGGTTCGAATCCC
GTACGGGTCATCCagaagccttgcatatcctgcaaggtttttttgtttttataaatcatgatatgtcttagattttgttctttattttaaa
aacagactacaaaaatctccatatatttcgtttttcttcagaaaatgaagttaattgtctataagtataagcgctttcaggaaagggcttttttttattt
cttcgaataaatactataaatgaaaactatgatgtcagaaaggatgattacATG

    glgB --- glgC --- glgD --- glgA --- glgP Gene: glgB     GI: 16080150     BI number: BSU30980     GOG: COG0296     Description: 1,4-alpha-glucan branching enzyme Gene: glgC     GI: 16080149     BI number: BSU30970     GOG: COG0448     Description: glucose-1-phosphate adenylyltransferase Gene: glgD     GI: 16080148     BI number: BSU30960     GOG: COG0448     Description: ADP-glucose pyrophosphorylase Gene: glgA     GI: 16080147     BI number: BSU30950     GOG: COG0297     Description: starch (bacterial glycogen) synthase Gene: glgP     GI: 16080146     BI number: BSU30940     GOG: COG0058     Description: glycogen phosphorylas            TA           G  C            CG            CG            CG           |  T           |  C        t           |  A      a  c           T  T      t  c           A  C       at           A  C       cg           G  a       gc   G        Cg        ta C  A       Ta        ta T  A       Ta        cg T  T      G  g       cg GC        Gc        gt GC        Gc        at GC       C  t       at CG        At        gt AT        Cg        at                         ttgtttttataaatcatgatatgtcttagattttgttctttattttaaaaacagactacaaaaatctccatatatttcgtttttcttcagaaaatgaagttaattgtctataagtataagcgctttcaggaaagggcttttttttatttcttcgaataaatactataaatgaaaactatgatgtcagaaaggatgattacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG0296 1,4-alpha-glucan branching enzyme ... can be seen here [G] COG0448 ADP-glucose pyrophosphorylase ... can be seen here [G] COG0448 ADP-glucose pyrophosphorylase ... can be seen here [G] COG0297 Glycogen synthase ... can be seen here [G] COG0058 Glucan phosphorylase ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_subtilis                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:199 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G=-11.20 kcal/mol Antiterminator: Size=39 nt.     Delta G= -9.30 kcal/mol Anti-antiterminator:   Size=33 nt.     Delta G= -3.90 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case CGTTGGTCAAGCGGTTAAGACACCGCCCTTTCACGGCGGTAACACGGGTTCGAATCCC GTACGGGTCATCCagaagccttgcatatcctgcaaggtttttttgtttttataaatcatgatatgtcttagattttgttctttattttaaa aacagactacaaaaatctccatatatttcgtttttcttcagaaaatgaagttaattgtctataagtataagcgctttcaggaaagggcttttttttattt cttcgaataaatactataaatgaaaactatgatgtcagaaaggatgattacATG     glgB --- glgC --- glgD --- glgA --- glgP Gene: glgB     GI: 16080150     BI number: BSU30980     GOG: COG0296     Description: 1,4-alpha-glucan branching enzyme Gene: glgC     GI: 16080149     BI number: BSU30970     GOG: COG0448     Description: glucose-1-phosphate adenylyltransferase Gene: glgD     GI: 16080148     BI number: BSU30960     GOG: COG0448     Description: ADP-glucose pyrophosphorylase Gene: glgA     GI: 16080147     BI number: BSU30950     GOG: COG0297     Description: starch (bacterial glycogen) synthase Gene: glgP     GI: 16080146     BI number: BSU30940     GOG: COG0058     Description: glycogen phosphorylas            TC           A  C            AC            GG   A        CT T  A      |  A G  C      |  C G  A      |  G GC       T  G TG       T  G        t A  G      G  T      a  c cG       G  C      t  c aT        GA        at t  T       CT        cg t  C       AC        gc a  G      C  C       ta g  A       Aa        ta tA        Ag        cg aT       T  a       cg gC        Ga        gt gC        Gg        at                         tttttgtttttataaatcatgatatgtcttagattttgttctttattttaaaaacagactacaaaaatctccatatatttcgtttttcttcagaaaatgaagttaattgtctataagtataagcgctttcaggaaagggcttttttttatttcttcgaataaatactataaatgaaaactatgatgtcagaaaggatgattacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG0296 1,4-alpha-glucan branching enzyme ... can be seen here [G] COG0448 ADP-glucose pyrophosphorylase ... can be seen here [G] COG0448 ADP-glucose pyrophosphorylase ... can be seen here [G] COG0297 Glycogen synthase ... can be seen here [G] COG0058 Glucan phosphorylase ... can be seen here     ..................................................................................................................