Gene putatively regulated by attenuation in B_subtilis

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:106 nt.    Distance to gene:121 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G= -6.50 kcal/mol
Antiterminator:    Distance from promoter:70 nt. Size=39 nt.     Delta G= -5.60 kcal/mol
Anti-antiterminator:    Distance from promoter:31 nt.    Size=49 nt.     Delta G= -9.20 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgctt-taaaat. It has a score value of 69.61 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgcttagtgaaaatgcgaaacccgttaaaatcaaggagattaagaatctttctcaatttcagcacatataaacgctctttcgcatagaaagatagtccc
gttcttgttgtgattcctttgagtataaggacctattgagatttgcggtgtcacgcaggacttttttgcatacttttcggtgaaaaatgagccgaaagca
gacacactattagtaacagatcaaatacctaggactcgttcaccatacacaattcattgatctttcaaaaaaaggagtgtggaaacgATG

    degQ


Gene: degQ     GI: 16080223     BI number: BSU31720     GOG: -------     Description:


  a
c  t
g  a
 cg
 ta
 ta
 ta
 cg         g
 ta       a  t
|  t      g  a
|  a      t  t
|  g       ta
|  t       ta
|  c       cg
c  c       cg
 gc        ta
 cg       t  c       gt
 at       a  c      t  c
 at        gt       g  a
a  c       ta        gc
t  t       gt        cg
 at       t  t       gc
 tg       t  |       ta
|  t      g  |       tg
 at        tg        tg
 cg        ta       a  a
 at        cg        gc
 cg        ta        at
                        tttttgcatacttttcggtgaaaaatgagccgaaagcagacacactattagtaacagatcaaatacctaggactcgttcaccatacacaattcattgatctttcaaaaaaaggagtgtggaaacgATG


    ..................................................................................................................