                                                                        Gene putatively regulated by attenuation in B_subtilis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:71 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-19.10 kcal/mol
Antiterminator: Size=36 nt.     Delta G= -4.60 kcal/mol
Anti-antiterminator:   Size=41 nt.     Delta G= -4.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATATGGTAGAGACGCTAGAGCGCTTTATTGAAGCGGACAGCAACGTGAATACCGCTTC
CAAGCTGTTAAATATACACGTTAATACGTTGAATTACCGACTCAAGCGGATCAGCCAG
ATCGCTGAAATTGATTTGAAAAATGTGAATCAAAAATTCACCATCTATTTAGATATCA
AACCTTCCGGCACATGGATTTGTGAAATTTCACAAATCCATGTTTTTTTATTTTCTTA
AtcaaacaaagaattttccaaaatatcaagctacactaaaaatatcacatatacaggaggagacagatATG

    ald Gene: ald     GI: 16080244     BI number: BSU31930     GOG: COG0686     Description: L-alanine dehydrogenas   A A  A C  A TA         A AT       C  C AT       G  A GC        GT        AT TA        CG       A  T GC        CG        AT |  C       TA        GC |  A      T  T       TA T  T      C  T       GC A  C      C  T       TA A  T      A  G       TA A  A      A  |       TA AT        AT        AT AT        CG        GC GT        TA        GC TA       A  A       TA TG        TA        AT TA        AT        CG AT        GT        AT                         TTTTTTATTTTCTTAAtcaaacaaagaattttccaaaatatcaagctacactaaaaatatcacatatacaggaggagacagatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0686 Alanine dehydrogenase ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_subtilis                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:78 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-19.10 kcal/mol Antiterminator: Size=36 nt.     Delta G= -4.60 kcal/mol Anti-antiterminator:   Size=17 nt.     Delta G= -3.30 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ATATGGTAGAGACGCTAGAGCGCTTTATTGAAGCGGACAGCAACGTGAATACCGCTTC CAAGCTGTTAAATATACACGTTAATACGTTGAATTACCGACTCAAGCGGATCAGCCAG ATCGCTGAAATTGATTTGAAAAATGTGAATCAAAAATTCACCATCTATTTAGATATCA AACCTTCCGGCACATGGATTTGTGAAATTTCACAAATCCATGTTTTTTTATTTTCTTA AtcaaacaaagaattttccaaaatatcaagctacactaaaaatatcacatatacaggaggagacagatATG     ald Gene: ald     GI: 16080244     BI number: BSU31930     GOG: COG0686     Description: L-alanine dehydrogenas             T           A  C           T  A            AA        AT            GA       A  T            AC        AT            TC        GC           T  T       TA           T  T       GC           A  C       TA   A       T  C       TA A  A      C  |       TA C  A       TG        AT TA        AG        GC AT        CC        GC AT       C  A       TA GC        AC        AT TA        CA        CG GC        TT        AT                         TTTTTTATTTTCTTAAtcaaacaaagaattttccaaaatatcaagctacactaaaaatatcacatatacaggaggagacagatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0686 Alanine dehydrogenase ... can be seen here     ..................................................................................................................