                                                                        Gene putatively regulated by attenuation in B_subtilis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:45 nt.     Distance to run of Ts=3 nt.   Size=20 nt.     Delta G= -6.30 kcal/mol
Antiterminator: Size=60 nt.     Delta G=-10.80 kcal/mol
Anti-antiterminator:   Size=36 nt.     Delta G=-10.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTTGCGAGTTTTCAGGAGAAGGACATATTTCAGTTCTTCCTGTTTTGGTCAGCAGGGC
GCTGCGTTTTGCGCTTCACCCTGACGGACCGCATCTATCAATGGGCTGAgacatactcagcctt
gcctttaaaaaaatatttgtcactgaaattatatttgactgtcacatgacatttggatatgattatttttataattgataatgataatcattatcaatag
attgcgtttttcaaggcgcagcagtctttttcgctggatgtctgtttggcatttagagcgaagaaaggaattgatgatATG

    dhbA --- dhbC --- dhbE --- dhbB --- dhbF Gene: dhbA     GI: 16080253     BI number: BSU32000     GOG: COG1028     Description: 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase Gene: dhbC     GI: 16080252     BI number: BSU31990     GOG: COG1169     Description: isochorismate synthase Gene: dhbE     GI: 16080251     BI number: BSU31980     GOG: COG1021     Description: 2,3-dihydroxybenzoate-AMP ligase (enterobactin synthetase component E) Gene: dhbB     GI: 16080250     BI number: BSU31970     GOG: COG1535,COG3433     Description: isochorismatase Gene: dhbF     GI: 50812288     BI number: BSU31960     GOG: COG1020,COG3319     Description:             a           t  a           a  t            gc            ta            at            at            ta            at            gc            ta            ta            at           a  |           t  |           a  | ca       t  | a  t      t  | cg        ta ta        tg gc        ta ta        at c  t      t  t at       t  g gt       a  |       tc t  g       gc       t  a t  g       tg        ta ta        at        tg at       |  t       tg ta       t  t       gc at        at        cg tg        gt        gc ta        gc        ta at        ta        tg                         cagtctttttcgctggatgtctgtttggcatttagagcgaagaaaggaattgatgatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [IQR] COG1028 Dehydrogenases with different specificities (related to short-chain alcohol dehydrogenases) ... can be seen here [HQ] COG1169 Isochorismate synthase ... can be seen here [Q] COG1021 Peptide arylation enzymes ... can be seen here [Q] COG1535 Isochorismate hydrolase ... can be seen here [Q] COG3433 Aryl carrier domain ... can be seen here [Q] COG1020 Non-ribosomal peptide synthetase modules and related proteins ... can be seen here [Q] COG3319 Thioesterase domains of type I polyketide synthases or non-ribosomal peptide synthetases ... can be seen here     ..................................................................................................................