Gene putatively regulated by attenuation in B_subtilis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:85 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-15.90 kcal/mol
Antiterminator: Size=74 nt.     Delta G=-11.05 kcal/mol
Anti-antiterminator:   Size=47 nt.     Delta G=-11.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TATCAGTTTCGCGTTATGCGGATTCGCCAATTTTTCATCAATTGCGATTATGCTTGGT
ACGCTTGGCGGTTTAGCGCCCAGCCGCCGTTCAGATATCGCACGTCTCGGCCTGAAGG
CTGTTCTTGCAGGAACATTAGCCAATCTGCTCAGCGCAGCCATTGCCGGCATGTTTAT
ATAAacgataaaagctccttgcgtcagtgcaaggagcttttatgtatgaaaaacgggggataattgtattgtgtccgcttataatagcttttatact
aagaaaaagaaaaaaagttggaggcacctATG

    dapF


Gene: dapF     GI: 16080270     BI number: BSU32170     GOG: COG0253     Description: diaminopimelate epimeras


            A
          C  G
          T  C
           CG
           GC
           TA
           CG
          |  C
          |  C
           TA
           AT
           AT
          |  G
          |  C
          |  C
           CG
           CG
           GC
          A  |
          T  |
           TA
           AT
           CG
           AT
           AT
 GC       |  T
T  A      |  A
 TG       |  T
 CG       |  A
 TA       |  T
 TA       |  A
 GC       |  A
|  A      |  a
|  T      |  c
|  T      |  g
 TA       |  a
 CG       |  t
 GC       |  a
 GC       |  a
|  A      |  a       ca
A  A      |  a      t  g
 AT       |  g       gt
 GC       |  c       cg
T  T      |  t       gc
C  |      |  c       ta
 CG        Gc        ta
 GC        Gt        cg
 GT        At        cg
C  C       Cg        ta
 TA        Gc        cg
 CG        Tg        gc
                        ttttatgtatgaaaaacgggggataattgtattgtgtccgcttataatagcttttatactaagaaaaagaaaaaaagttggaggcacctATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[E] COG0253 Diaminopimelate epimerase ... can be seen here

    ..................................................................................................................