                                                                        Gene putatively regulated by attenuation in B_subtilis

This operon is putativelly rgulated by Cobalamin_riboswitch

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:24 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-13.40 kcal/mol
Antiterminator: Size=41 nt.     Delta G=-13.30 kcal/mol
Anti-antiterminator:   Size=54 nt.     Delta G=-15.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

cattcaggacacatatacaagcctgtcagtcatatagtataattactccgaaaaacggatacgaatgtcaaataggtgccggtccgtgaacaacagccgg
cttaaaagggaaaccggtaaaagccggtgcggtcccgccactgtaattggccaagcgccaagagccaggatacctgcctgtttgatcagcacgaattctg
cgaggacagatgatgtgtaaacaataggcttttttgtgttgtttacagcatctttaccgtcgtagagatgcttttttagttcgtttaggaggaaaagatt
ATG

    yvrC --- yvrB --- yvrA --- yvqK Gene: yvrC     GI: 16080371     BI number: BSU33180     GOG: COG0614     Description: - Gene: yvrB     GI: 16080370     BI number: BSU33170     GOG: COG0609     Description: - Gene: yvrA     GI: 16080369     BI number: BSU33160     GOG: COG1120,COG1865     Description: - Gene: yvqK     GI: 16080368     BI number: BSU33150     GOG: COG2096     Description: ag g  g c  a gc ta cg ta        tt t  t      t  t a  g      t  t a  a       cg gt        gt cg       g  | at       a  | cg        tg gt        at a  a       at        gt c  a       cg       c  c t  a       at        cg a  c       at        at g  |       at        ta t  |       ta        tg ta        gc        ta ta        ta        cg gt       |  g       ta ta        gc        at cg        ta        cg cg        at        gc gc        gc        at                         tttttagttcgtttaggaggaaaagattATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG0614 ABC-type Fe3+-hydroxamate transport system, periplasmic component ... can be seen here [P] COG0609 ABC-type Fe3+-siderophore transport system, permease component ... can be seen here [PH] COG1120 ABC-type cobalamin/Fe3+-siderophores transport systems, ATPase components ... can be seen here [S] COG1865 Uncharacterized conserved protein ... can be seen here [S] COG2096 Uncharacterized conserved protein ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Cobalamin_riboswitch sequence ... can be seen here     ..................................................................................................................