                                                                        Gene putatively regulated by attenuation in B_subtilis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:99 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-13.50 kcal/mol
Antiterminator: Size=36 nt.     Delta G= -5.70 kcal/mol
Anti-antiterminator:   Size=34 nt.     Delta G= -8.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGAACGGATTTACAATGCTGTGGCTGCCGGGAACGGTGCACAGGCGGAAGCCGCCATG
CTGGCGCATTTGACGAATGTGGAAGATGTGCTTTCGGGATATTTCGAGGAAAATGTGC
AATAAccaactcatttcccgggcaattccgccggttccgaatgatacgaacaactgagactgagccgcaaatggttcagtctttttacatggcagcc
agagggctttgtgcacttgacatttgtgaaaaagaaagtaaaatattttactaaaacaatgcgagctgaataatggaggcagatacaATG

    lacR Gene: lacR     GI: 16080470     BI number: BSU34170     GOG: COG1609     Description: transcriptional regulator (LacI family tt         c a  c      a  g a  c      t  a cg       a  a gc        gc g  |       ta gc       a  a cg       a  c       aa cg        gt       c  a |  t       cg        gt |  t      c  a       cg |  c      t  g       cg c  c       ta        gt tg        gc        at ta        gt        gc ta        cg        ta at       |  a       cg cg        cg        at ta        gc        gc                         tttttacatggcagccagagggctttgtgcacttgacatttgtgaaaaagaaagtaaaatattttactaaaacaatgcgagctgaataatggaggcagatacaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG1609 Transcriptional regulators ... can be seen here     ..................................................................................................................