                                                                        Gene putatively regulated by attenuation in B_subtilis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:193 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-18.70 kcal/mol

                                                                        Nomenclature/Definitions

GCCAAAGGGGCTTGTAGATGATAACGAAGCCGCTGTTATTGCCAAATGGCTGTCAGAA
AAAAAGTAAgataaaaacatccttgccgagtgctggcaaggatgtttttatgccttgacaatatgaatgaaaagaaactgtaatagtattatgt
ctaaatttgacgtataatgaagtgtattgaaaaagggaactttcagatttttcatctttttacaaatgaatgggtcataaattgtcgaatgcattcgaag
agtatgaccgtgtgatagataaaatgatataaaagattaggtgatttcATG

    ftsE --- ftsX Gene: ftsE     GI: 16080579     BI number: BSU35260     GOG: COG2884     Description: cell-division ATP-binding protein Gene: ftsX     GI: 16080578     BI number: BSU35250     GOG: COG2177     Description: cell-division protei            t          g  g          a  c           gt           cg           cg           gc           ta           ta           cg           cg           ta           at           cg           at             ttttatgccttgacaatatgaatgaaaagaaactgtaatagtattatgtctaaatttgacgtataatgaagtgtattgaaaaagggaactttcagatttttcatctttttacaaatgaatgggtcataaattgtcgaatgcattcgaagagtatgaccgtgtgatagataaaatgatataaaagattaggtgatttcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [D] COG2884 Predicted ATPase involved in cell division ... can be seen here [D] COG2177 Cell division protein ... can be seen here     ..................................................................................................................