                                                                        Gene putatively regulated by attenuation in B_subtilis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:59 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-13.20 kcal/mol
Antiterminator: Size=36 nt.     Delta G= -5.90 kcal/mol
Anti-antiterminator:   Size=68 nt.     Delta G=-21.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GACGAAGATGCGAGTAAAGGGTTGCCTATGCGAGCTGCTGTTATCCACGCTAATCGAG
AGGAAGAAGCAGCGAAAATCATTGAAGAGCTTTCTGCAAAATATCCTCATGTTGAATT
TTATAACAGCTATTTTGGCGCGGTAATCGGCACTCATTTGGGTGAAGGTGCGTTAGGA
ATTTGCTGGTGTTTTAAATAAggccaaatctccgtttttagagcggagatttttttatattcttattttaatagttggacagaaa
atattcattcaggcatactgtttcgaaaggaggcgtgctatGTG

    comFA --- comFB --- comFC Gene: comFA     GI: 16080600     BI number: BSU35470     GOG: COG4098     Description: late competence protein Gene: comFB     GI: 16080599     BI number: BSU35460     GOG: -------     Description: - Gene: comFC     GI: 16080598     BI number: BSU35450     GOG: COG1040     Description: TT A  T CG TG CG AT CG G  A G  A CG TG AT A  | T  | G  | G  | CG GC CG        AA GT       T  A GT       T  T TA        TA TG        TA TG       G  g        t TA        Tg       t  a |  A       Gc        tg |  T       Gc        ta A  T       Ta        tg T  T      C  |       gc CG       G  |       cg GC        Ta        cg AT        Ta        ta CG       T  t       cg A  G      A  c       ta AT        At        at TG        Gc        at AT        Gc        at                         ttttatattcttattttaatagttggacagaaaatattcattcaggcatactgtttcgaaaggaggcgtgctatGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG4098 Superfamily II DNA/RNA helicase required for DNA uptake (late competence protein) ... can be seen here [R] COG1040 Predicted amidophosphoribosyltransferases ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_subtilis                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:70 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-13.20 kcal/mol Antiterminator: Size=36 nt.     Delta G= -5.90 kcal/mol Anti-antiterminator:   Size=46 nt.     Delta G=-15.10 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case GACGAAGATGCGAGTAAAGGGTTGCCTATGCGAGCTGCTGTTATCCACGCTAATCGAG AGGAAGAAGCAGCGAAAATCATTGAAGAGCTTTCTGCAAAATATCCTCATGTTGAATT TTATAACAGCTATTTTGGCGCGGTAATCGGCACTCATTTGGGTGAAGGTGCGTTAGGA ATTTGCTGGTGTTTTAAATAAggccaaatctccgtttttagagcggagatttttttatattcttattttaatagttggacagaaa atattcattcaggcatactgtttcgaaaggaggcgtgctatGTG     comFA --- comFB --- comFC Gene: comFA     GI: 16080600     BI number: BSU35470     GOG: COG4098     Description: late competence protein Gene: comFB     GI: 16080599     BI number: BSU35460     GOG: -------     Description: - Gene: comFC     GI: 16080598     BI number: BSU35450     GOG: COG1040     Description: TT A  T CG TG CG AT CG        TG G  A      G  T G  A      G  T CG        TT TG        CT AT       G  A        t A  |       TA       t  a T  |       TA        tg G  |       TT        ta G  |       AA        tg CG       A  |       gc GC       G  |       cg CG        GA        cg GT        Ag        ta GT       T  g       cg TA       T  c       ta TG        Gc        at TG        Ca        at TA        Ga        at                         ttttatattcttattttaatagttggacagaaaatattcattcaggcatactgtttcgaaaggaggcgtgctatGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG4098 Superfamily II DNA/RNA helicase required for DNA uptake (late competence protein) ... can be seen here [R] COG1040 Predicted amidophosphoribosyltransferases ... can be seen here     ..................................................................................................................