                                                                        Gene putatively regulated by attenuation in B_subtilis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:123 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-15.70 kcal/mol
Antiterminator: Size=77 nt.     Delta G= -9.08 kcal/mol
Anti-antiterminator:   Size=51 nt.     Delta G= -8.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AACGGCCTTGACCAGCTGCTTGCTGAAGAGCTGAAGGTACCGGTCCTCGTTGCTGAAA
ATCCTATGGATTGCGTAGCCATCGGCACAGGTGTCATGCTTGATAATATGGACAAGCT
TCCTAAACGCAAACTAAGCTGAtttcacaaacctcattctgaaaaagaatgaggtttttttatgaaaaagccttcacgaaaaga
tgttaaatgacgataataggataaaatactgagtttttattatagaacgaacgttcctatatgacaactggaaaaaatgccatttttagaggtgggaaat
TTG

    flhO --- flhP Gene: flhO     GI: 16080693     BI number: BSU36400     GOG: COG4786     Description: flagellar basal-body rod protein Gene: flhP     GI: 16080692     BI number: BSU36390     GOG: COG4786     Description: flagellar hook-basal body protei            AG           A  C           C  T            AT            GC            GC           |  T           |  A           |  A           |  A           T  C           A  G           T  C           A  A           A  A           T  A           A  C            GT CA        TA G  C       TA G  A       CG CG        GC TG       T  | AT        AT C  |       CG CG        TA GT        Gt A  C      |  t TA       |  t GT       |  c CG       |  a        a GC       |  c      a  a |  T      |  a      g  a T  T      |  a       ta T  G       Ta        cg A  A       Gc        ta G  T       Gc        ta G  A       At        at TA       |  c       cg AT       C  a       ta TA       A  t       cg |  T      C  t       cg CG        Gc        at CG        Gt        at TA        Cg        at                         ttttatgaaaaagccttcacgaaaagatgttaaatgacgataataggataaaatactgagtttttattatagaacgaacgttcctatatgacaactggaaaaaatgccatttttagaggtgggaaatTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [N] COG4786 Flagellar basal body rod protein ... can be seen here [N] COG4786 Flagellar basal body rod protein ... can be seen here     ..................................................................................................................