                                                                        Gene putatively regulated by attenuation in B_subtilis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:146 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-15.80 kcal/mol
Antiterminator: Size=47 nt.     Delta G= -6.15 kcal/mol
Anti-antiterminator:   Size=54 nt.     Delta G=-16.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGAATCGGAGCTTTGAAAAAGATGATCAAAACCGTTATCAAATGGGCGCCGGTCATTT
ACCCGATTGTTCGAAAAATCATGAAGGACCGCAAGGCGTCTAAACAAAAGAATATGTC
CGCATCTAGAACAGCCGGCTGAtcccggctgtttttttataggtcagttttccctctagtcctccggatgttcattgacttgcc
attctctccattatagaatttatatacatttcgcatcccttcatcatcctttctgcctattcactgaatccctgcatctactagttaggaggtttttctc
ATG

    licR Gene: licR     GI: 16080911     BI number: BSU38600     GOG: COG1762,COG3711     Description: transcriptional regulato CG T  A T  A G  A TA TA        TA AT       A  T GC       A  G C  A      G  T C  |      A  C C  |      A  C AT       A  G TG       A  C TA       C  A TA       A  T A  G      A  C CG        AT TA        TA        GA GC        CG       T  t GC        TA       C  c |  G      |  A       Gc |  C      |  C       Gc |  A      G  A       Cg |  A       CG        Cg CG        GC        Gc CG        GC        At GC       A  G       Cg CG       A  |       At GT        CG        At GC        GC        Gt                         ttttataggtcagttttccctctagtcctccggatgttcattgacttgccattctctccattatagaatttatatacatttcgcatcccttcatcatcctttctgcctattcactgaatccctgcatctactagttaggaggtttttctcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [GT] COG1762 Phosphotransferase system mannitol/fructose-specific IIA domain (Ntr-type) ... can be seen here [K] COG3711 Transcriptional antiterminator ... can be seen here     ..................................................................................................................