                                                                        Gene putatively regulated by attenuation in B_subtilis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:42 nt.     Distance to run of Ts=0 nt.   Size=39 nt.     Delta G=-21.20 kcal/mol
Antiterminator: Size=44 nt.     Delta G=-11.40 kcal/mol
Anti-antiterminator:   Size=67 nt.     Delta G=-12.56 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCAGAGGTGAAATGCTGCTGGGATCGCTGCTTCGGACGGTGGGATTGAGGTTTGCCGT
TTTGAGGGGAAATCCTTATGAAAGTGAAGCGGAAGGCGATTGGATCGCTGTCTCGCTT
TACGGAACAATCGGGGCGCCGATTAAAGGTCTTGAGCATGAAACATTCGGCGTTGGAA
TTAATCACATATGAaacagcccatagatcttagacgatagggggctatgcgtgaaaacagaagttcacagcatagctcctttttgtatgg
gcgctttaccaaagtaaagaaaaaggagttgggcttATG

    hutH --- hutU --- hutI --- hutG Gene: hutH     GI: 16080986     BI number: BSU39350     GOG: COG2986     Description: histidase Gene: hutU     GI: 16080987     BI number: BSU39360     GOG: COG2987     Description: urocanase Gene: hutI     GI: 16080988     BI number: BSU39370     GOG: COG1228     Description: imidazolone-5-propionate hydrolase Gene: hutG     GI: 16080989     BI number: BSU39380     GOG: COG0010     Description: formiminoglutamate hydrolas   C A  A AT AT GC TG A  | CG GC A  G G  T T  T TG CG TA G  A G  | A  |       ag AT       t  a AT       t  c TA        cg        ag TA        ta       c  a AT        at       a  a GC       g  a      a  g |  A      a  g       at |  C      t  g       at |  A      a  |       gc |  T       cg        ta |  A       cg        gc |  T       cg       |  a |  G       gc        cg |  A       at        gc |  a      c  a       ta C  a      a  t       at C  c      a  g       ta G  a      A  |       cg Cg        Gc        gc Gc        Tg        gt Gc        At        gc Gc        Tg        gc                         tttttgtatgggcgctttaccaaagtaaagaaaaaggagttgggcttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG2986 Histidine ammonia-lyase ... can be seen here [E] COG2987 Urocanate hydratase ... can be seen here [Q] COG1228 Imidazolonepropionase and related amidohydrolases ... can be seen here [E] COG0010 Arginase/agmatinase/formimionoglutamate hydrolase, arginase family ... can be seen here     ..................................................................................................................