                                                                        Gene putatively regulated by attenuation in B_subtilis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:94 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-18.00 kcal/mol
Antiterminator: Size=34 nt.     Delta G= -8.00 kcal/mol
Anti-antiterminator:   Size=54 nt.     Delta G= -6.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATGACCGCTGATCCCGACGACACAAGAGGCTTTGACGGCGCGCTCGCAGAACTCGCGC
AGCAGCCGCATGGCAAATTGATTCTGTCTATATTGGCATTAGGCCTGATCCTATATGG
AATGTACGCCATTATGAAAGGCATTTATCAGCATATGACTTGGAGAAGTAAGCTCTGG
GCAGGTCCGCGCCCAGAGCGTTTTTCAGTTTCTTAGaaatcaggtggatgaaagccggcgccagcctgtataa
taaaagcaaatcaaaagcagttttatcaggactgatccacagggaggtgcagaATG

    deoR Gene: deoR     GI: 16080994     BI number: BSU39430     GOG: COG2390     Description: transcriptional regulato   T A  G T  A T  A A  A CG CG GC C  A A  T T  T GT         T TA       G  A AT       A  A |  C      A  G A  A       GC G  G       AT GC        GC        TC TA       G  T      G  C AT       T  G      G  G TA        TG       A  C AT        CG        CG TG       A  |       GC |  A       GC        GC |  C       TA        GC |  T      A  G       TA |  T      T  |       CG CG       A  |       TA CG        CG        CG TA        GT        GC                         GTTTTTCAGTTTCTTAGaaatcaggtggatgaaagccggcgccagcctgtataataaaagcaaatcaaaagcagttttatcaggactgatccacagggaggtgcagaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG2390 Transcriptional regulator, contains sigma factor-related N-terminal domain ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_subtilis                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:102 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-18.00 kcal/mol Antiterminator: Size=34 nt.     Delta G= -8.00 kcal/mol Anti-antiterminator:   Size=57 nt.     Delta G= -9.20 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ATGACCGCTGATCCCGACGACACAAGAGGCTTTGACGGCGCGCTCGCAGAACTCGCGC AGCAGCCGCATGGCAAATTGATTCTGTCTATATTGGCATTAGGCCTGATCCTATATGG AATGTACGCCATTATGAAAGGCATTTATCAGCATATGACTTGGAGAAGTAAGCTCTGG GCAGGTCCGCGCCCAGAGCGTTTTTCAGTTTCTTAGaaatcaggtggatgaaagccggcgccagcctgtataa taaaagcaaatcaaaagcagttttatcaggactgatccacagggaggtgcagaATG     deoR Gene: deoR     GI: 16080994     BI number: BSU39430     GOG: COG2390     Description: transcriptional regulato GT T  A A  C A  G GC GC TA AT T  | AT TA C  T        A CG       C  T TA       G  A A  A      A  T G  |       CG TA        TA CG        AC        TC CG       T  T      G  C GC       T  T      G  G G  A       TG       A  C A  T       AG        CG T  T      C  |       GC T  T       GA        GC A  A       GG        GC C  |      A  A       TA GT       A  |       CG GC       A  |       TA TA        GA        CG TG        TG        GC                         GTTTTTCAGTTTCTTAGaaatcaggtggatgaaagccggcgccagcctgtataataaaagcaaatcaaaagcagttttatcaggactgatccacagggaggtgcagaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG2390 Transcriptional regulator, contains sigma factor-related N-terminal domain ... can be seen here     ..................................................................................................................